ID: 911117497

View in Genome Browser
Species Human (GRCh38)
Location 1:94260990-94261012
Sequence ATGGGGGTGCAGAATTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911117497_911117504 24 Left 911117497 1:94260990-94261012 CCTTCCTAATTCTGCACCCCCAT 0: 1
1: 0
2: 3
3: 27
4: 393
Right 911117504 1:94261037-94261059 TCTTGAAACATTAAAAAACCAGG 0: 1
1: 0
2: 9
3: 40
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911117497 Original CRISPR ATGGGGGTGCAGAATTAGGA AGG (reversed) Intronic
900120186 1:1045560-1045582 ATGGGGGTGAACAGGTAGGAGGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902678566 1:18027020-18027042 ATATAAGTGCAGAATTAGGATGG - Intergenic
903395700 1:23000326-23000348 ATGGTGGTGCAGGATATGGAAGG + Intergenic
905429567 1:37911675-37911697 ATGGTGGTGCAGGATATGGAAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
909729776 1:78876848-78876870 ATGGTGGTGCAGGATATGGAAGG - Intergenic
909945778 1:81661854-81661876 ATGGGGGTGCAGCATTAGGGAGG - Intronic
911055112 1:93702191-93702213 ATGGGGGCGCAGCTTCAGGAAGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911147685 1:94568397-94568419 ATGGTGGTGCAGGATATGGAAGG + Intergenic
912815031 1:112822142-112822164 ATGGTGGTGCAGTATATGGAAGG + Intergenic
912939175 1:114030033-114030055 ATGGTGGTGCAGGATATGGAAGG - Intergenic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
913095438 1:115511713-115511735 ATGGTGGTGCAGGATATGGAAGG + Intergenic
913245472 1:116866661-116866683 ATGGTGGTGCAGGATATGGAAGG - Intergenic
916329081 1:163594740-163594762 ATGGTGGTGCAGGATATGGAAGG - Intergenic
917467052 1:175289034-175289056 TTGGGGGTGCAGCATTACAATGG - Intergenic
917482433 1:175423752-175423774 ATGGGGCTGCGGAACTAGGGTGG + Intronic
917639353 1:176968105-176968127 ATGGGGTTACAGAATGATGAAGG - Intronic
917749953 1:178044146-178044168 ATGGTGGTGCAGGATATGGAAGG - Intergenic
918131897 1:181636969-181636991 ATGGGGGTGCATATTGAAGAGGG - Intronic
920427029 1:205886626-205886648 ATGGTGGTGCAGGATATGGAAGG + Intergenic
920529275 1:206690194-206690216 ATGGGCTTACAGAATTATGAGGG + Intronic
920657337 1:207886767-207886789 ATGGGGGTGCAGAGCAAGGAAGG + Exonic
920901308 1:210112803-210112825 ATGGTGGTGCAGGATATGGAAGG + Intronic
920908336 1:210191667-210191689 ATGGTGGTGCAGGATATGGAAGG - Intergenic
921205425 1:212844726-212844748 ATGGTGGTGCAGGATATGGAAGG - Intronic
922049728 1:221977759-221977781 ATTGGGGTGCAGAGATAGGTTGG + Intergenic
922363252 1:224841978-224842000 ATGGTGGTGCAGGATATGGAAGG + Intergenic
922935102 1:229416554-229416576 ATGGTGGTGCAGAATATGAAAGG - Intergenic
924895897 1:248337765-248337787 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1063313924 10:4983612-4983634 ATGGGTGGAGAGAATTAGGATGG - Intronic
1063327863 10:5123080-5123102 ATGGGTGGAGAGAATTAGGATGG - Intronic
1064357700 10:14634750-14634772 GTGGGGGTGGAGATTTAGGCAGG + Intronic
1067157497 10:43794420-43794442 ACAGGGGTGCAGAATGAGGGAGG - Intergenic
1067162912 10:43842379-43842401 ATGGGGCTGGAGGAGTAGGAGGG + Intergenic
1067360631 10:45574932-45574954 ATGGTGGTGCAGGATATGGAAGG - Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1070893749 10:79964192-79964214 ATGGTGGTGCAGGATATGGAAGG - Intronic
1070939043 10:80327006-80327028 ATGGGGGTGGAGGACAAGGAAGG - Intergenic
1071822030 10:89288847-89288869 ATGGTGGTGCAGGATATGGAAGG - Intronic
1072884770 10:99263387-99263409 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1073395018 10:103210449-103210471 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1079847361 11:25488544-25488566 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1080696374 11:34606295-34606317 ATGAGGCTGCAGAAATAGGTAGG + Intergenic
1080994223 11:37580566-37580588 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1081121907 11:39277286-39277308 ATGGGGCTGTGGAAATAGGAAGG - Intergenic
1081160053 11:39738956-39738978 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1081342736 11:41947782-41947804 ATGGGGGTGCAGACCTAGCCCGG + Intergenic
1083249416 11:61455916-61455938 ATGGGTGTGCAGATGTGGGAAGG - Intronic
1084245785 11:67856096-67856118 ATCGGGGTGCAGAGATAAGAGGG + Intergenic
1084354535 11:68628696-68628718 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1085431548 11:76454927-76454949 AAGGGTGGGCAGTATTAGGAGGG - Intronic
1085829083 11:79880523-79880545 GTGGGGGTGCAGAATGGGCATGG + Intergenic
1085843634 11:80041759-80041781 TTGGGGGTGGGGAATTAGAATGG - Intergenic
1086133375 11:83422825-83422847 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1086134516 11:83432947-83432969 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086135962 11:83444236-83444258 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1086457546 11:86974228-86974250 ATGGGGGTGGTGAATTTAGAGGG + Intergenic
1086658355 11:89385157-89385179 ATGGTGGTGCAGGATATGGAAGG - Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1087167750 11:95021818-95021840 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1087197200 11:95313691-95313713 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1087292212 11:96332031-96332053 CTGTGGGTGCAGAATTTGGGAGG + Intronic
1089953655 11:122551508-122551530 ACGGTGGTGCAGAATATGGAAGG - Intergenic
1090330154 11:125925051-125925073 ATTGGGGTTCAAAACTAGGATGG - Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093358775 12:18199504-18199526 ATGGTGGTGCAGAATATGAAAGG - Intronic
1093781615 12:23143612-23143634 ATGGATGTGGAGAAATAGGAAGG - Intergenic
1094400992 12:30060368-30060390 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1094826071 12:34270114-34270136 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1095304504 12:40623936-40623958 ATGAGGGTGGAGAGTTAGGAAGG + Intergenic
1095637920 12:44453965-44453987 ATGGTGGTGCAGAATACGAAAGG - Intergenic
1095806441 12:46325264-46325286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1095998700 12:48111448-48111470 ATGGTGGTGCAGGATATGGAAGG + Intronic
1096813207 12:54184697-54184719 AGGGGGTTGTAGAATTAGCAGGG - Intronic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097300228 12:58010131-58010153 GTGGGGGTGCAGAATGATGATGG + Intergenic
1097541875 12:60953303-60953325 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1098718711 12:73866932-73866954 ATGAGGTTGGAGAATTAGGTGGG - Intergenic
1099277386 12:80594345-80594367 GTGGCAGTGCAGTATTAGGATGG + Intronic
1100132677 12:91515846-91515868 ATGGGGGTAAAGAATTTGCATGG + Intergenic
1100245101 12:92749813-92749835 AGTGGGATGCAGCATTAGGATGG - Intronic
1100940628 12:99719670-99719692 ATGGTGGTGCAGAATATGGAAGG - Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1102604830 12:114060390-114060412 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1104257934 12:127156125-127156147 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1104375645 12:128263880-128263902 TTGGGGGTGCAACTTTAGGAAGG - Intergenic
1105032613 12:132894571-132894593 ATGGTGGTGCAGAATATGGAAGG - Intronic
1106638565 13:31558289-31558311 AAGAGGGTGCAGAAGTAGCAGGG + Intergenic
1108803585 13:54129216-54129238 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1108853817 13:54768622-54768644 ATGGAGGTGCTGAGTTGGGAGGG + Intergenic
1109353225 13:61209186-61209208 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1110845631 13:80187860-80187882 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1110978763 13:81870360-81870382 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1112482898 13:99793286-99793308 ATAGGGGTGTGAAATTAGGATGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1117174471 14:53132622-53132644 ATGGTGGTGCAGGATATGGAAGG - Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1119577891 14:75744321-75744343 ATGCGAGTGGAGAAATAGGAAGG - Intronic
1120539281 14:85734502-85734524 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1121451203 14:94009260-94009282 ATGGGGGTGCTGAATGTGTAGGG + Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121832706 14:97065890-97065912 ATGGAGGGGCCAAATTAGGATGG + Intergenic
1121980316 14:98448804-98448826 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1123105196 14:105838026-105838048 CTGGGGGTGCTGACTAAGGAGGG + Intergenic
1123756445 15:23400910-23400932 ATTGTGTTCCAGAATTAGGATGG - Intergenic
1126169057 15:45679331-45679353 TTTGGGGTGCAGATTGAGGATGG + Intronic
1126662930 15:51049704-51049726 ATGGGGCTGCAGGATGATGAGGG + Intergenic
1126841324 15:52719996-52720018 AAGGAGGTGCAGAATTCAGAAGG - Intergenic
1126844086 15:52743133-52743155 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127957057 15:63862834-63862856 ATCAGGGTGCAGACTCAGGATGG + Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1129259698 15:74358017-74358039 ATGGTGGTGCAGGATATGGAAGG - Intronic
1133585576 16:7191120-7191142 ATGATGGTGAAGAATTAAGATGG - Intronic
1133869262 16:9672619-9672641 ATGGTGGTGCAGAATATGAAAGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134329314 16:13235859-13235881 ATGGGGGTAGAGAATGAGGGAGG + Exonic
1134459893 16:14421818-14421840 ATTGTGTTCCAGAATTAGGATGG + Intergenic
1135025123 16:18993747-18993769 ATGGTGGTGCAGGATATGGAAGG + Intronic
1135641002 16:24119644-24119666 TTGGGGGTGATGATTTAGGAGGG + Intronic
1136530253 16:30863381-30863403 ATGGTGGTGCAGGATATGGAAGG - Intronic
1137896359 16:52216946-52216968 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1139074295 16:63424852-63424874 ATGGGTGGGCAGTCTTAGGAGGG + Intergenic
1142607128 17:1088097-1088119 CTGGGGCTGCAGATTTGGGAGGG - Intronic
1144001205 17:11056853-11056875 ATAGGGGTGAAGATTCAGGATGG + Intergenic
1145080390 17:19890148-19890170 ATGGTGGTGCAGGATACGGAAGG + Intergenic
1145095941 17:20026473-20026495 ATGGGGTCACAGAATTAGAAGGG - Intronic
1146952839 17:36918754-36918776 ATGGGGGTGCACAGGAAGGAAGG - Intergenic
1148441293 17:47712986-47713008 ATGGAGGTGGAGAAATAGCAGGG - Intergenic
1151503058 17:74504748-74504770 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1151765200 17:76130147-76130169 GTGGGGGTGCAGCGTGAGGAAGG + Intergenic
1152741454 17:82020236-82020258 ATGGGAGTGCAAGATTAGGCCGG - Intronic
1152835320 17:82526393-82526415 ATAGGGCTGGAGAATAAGGAAGG + Intronic
1155040968 18:22065536-22065558 ATGGAGGTGAAGAAGTAAGAGGG + Intergenic
1155941833 18:31807981-31808003 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1156302573 18:35848307-35848329 ATGGTGGTGCAGAATATAGAAGG - Intergenic
1156916115 18:42465796-42465818 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1157445401 18:47742757-47742779 TGGGGAGTGCAGATTTAGGATGG + Intergenic
1158132991 18:54173730-54173752 ATGGTGGAGCAGTATTAGTAAGG + Intronic
1158338913 18:56444516-56444538 ATGTGGCTGGAAAATTAGGAAGG - Intergenic
1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG + Intergenic
1160786065 19:900729-900751 ATGGGGGGGCAGGATATGGATGG - Intronic
1161533505 19:4804332-4804354 ATGGGGATGCAGAAGTAATAGGG - Intergenic
1162332855 19:10041072-10041094 ATGGCTGTGCAAAATTGGGAGGG - Intergenic
1162565208 19:11442150-11442172 ATGGGGCTGGAGAATCAGGCAGG + Intronic
1163209404 19:15829520-15829542 ATGTGGGTGAATAATTAGGCAGG - Intergenic
1163518896 19:17780485-17780507 CTGGGGGGGCAGAATTTGCAGGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164003691 19:21130557-21130579 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1164202196 19:23028174-23028196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1165249472 19:34517706-34517728 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167347534 19:48955648-48955670 GTGAGGGTGCAGAATCAGAACGG - Intronic
1167689828 19:50978487-50978509 ATGGGGGTGGAAAAGAAGGAGGG + Intronic
1167689844 19:50978574-50978596 ATGGGGGTGGAGAAGAAAGAGGG + Intronic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168576919 19:57519724-57519746 ATGTGGGTGCAGAATTGCCATGG + Intergenic
925433551 2:3817349-3817371 ATGGTGGTGCAGGATATGGAAGG + Intronic
927134435 2:20086399-20086421 ATGGTGGTGCAGGATATGGAAGG - Intergenic
927543501 2:23932551-23932573 GTGGGGGTGCAGGGTTGGGAGGG + Intronic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
929684202 2:44020365-44020387 ATGGTGGTGCAAGATAAGGAAGG + Intergenic
930098714 2:47586801-47586823 ATGGTGGTGCAGGATACGGAAGG + Intergenic
930706406 2:54508944-54508966 ATGGTGGTGCAGGATATGGAAGG + Intronic
931948078 2:67332673-67332695 ATTGGGGTGCAGAGATAGGTCGG - Intergenic
932143100 2:69296919-69296941 ATGGGGGTGCAGAATGGGTTTGG - Intergenic
932159162 2:69445106-69445128 ATGGTGGTGCAGGATATGGAAGG + Intergenic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
933138234 2:78762045-78762067 ATGGTGGTGCAGGATATGGAAGG - Intergenic
933145360 2:78845639-78845661 ATGTGGGTGTAAAAATAGGATGG + Intergenic
933179500 2:79213374-79213396 ATGGTGGTGCAGGATATGGAAGG + Intronic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
936794011 2:116185793-116185815 ATGGTGGTGCAGAATATGAAAGG + Intergenic
936889434 2:117351640-117351662 ATGGTTGTGCAGGATAAGGATGG + Intergenic
936970895 2:118175297-118175319 ATGGAGGTAGAGGATTAGGAAGG + Intergenic
937138565 2:119577277-119577299 ATGGAGGTGGGGACTTAGGAAGG - Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938571077 2:132562402-132562424 ATGAGGCTGAAGAATTAGGCAGG - Intronic
939460459 2:142491376-142491398 ATGGTGGTGCAGGATATGGAAGG + Intergenic
940183251 2:150957230-150957252 ATGGTGGTGCAGGATATGGAAGG - Intergenic
941455854 2:165711652-165711674 ATGGTGGTGCAGGATATGGAAGG + Intergenic
941750902 2:169134725-169134747 ATGGTGGTGCAGGATATGGAAGG - Intronic
943412645 2:187562015-187562037 ATGGTGGTGCAGAATATGAAAGG + Intronic
943916293 2:193637177-193637199 ATAGCAGTGCAGATTTAGGAAGG - Intergenic
944387734 2:199183553-199183575 ATGGTGGTGCAGAATATGAAAGG - Intergenic
944980190 2:205108686-205108708 AGGAGGGTACAGGATTAGGAAGG - Intronic
945361920 2:208903409-208903431 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945376390 2:209082252-209082274 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945554986 2:211265621-211265643 ATGGTGGTGCAGGATATGGAAGG - Intergenic
945858463 2:215094143-215094165 ATGGTGGTGCAGGATATGGAAGG - Intronic
945888758 2:215406190-215406212 GTGAGGGTGGAGAATTTGGAGGG + Intronic
946871442 2:224089174-224089196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
1168942993 20:1729289-1729311 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1170680123 20:18518919-18518941 ATGGTGGTGCAGGATATGGAAGG + Intronic
1172993285 20:39051333-39051355 TTGGGGGTGCAGATTTGGGGAGG - Intergenic
1173071657 20:39774105-39774127 ATGGTGGTACAAAATTAGGCTGG + Intergenic
1173652385 20:44674925-44674947 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1178298519 21:31431194-31431216 AAGGCGGTGCAGAATTAGGTAGG - Intronic
1178845132 21:36168366-36168388 TTTGGGGTGCATACTTAGGAGGG + Intronic
1179014936 21:37588257-37588279 ATGGTGGTGCAGGATATGGATGG + Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG + Intergenic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
950881356 3:16325351-16325373 AGGGAGGTGGAGGATTAGGAAGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951762470 3:26161700-26161722 ATGGTGGTGCAGAATATGGAAGG + Intergenic
952297216 3:32072133-32072155 ATGGTGGTGCAGGATATGGAAGG - Intronic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
952627602 3:35425819-35425841 AAGGGGGTGCTGAATTATAAGGG - Intergenic
952792132 3:37208228-37208250 ATGGTGGTGCAGGATATGGAAGG - Intergenic
952894879 3:38071819-38071841 ATGGTGGTGCAGAATATGAAAGG + Intronic
953656219 3:44856840-44856862 ATGGTGGTGCAGGATATGGAAGG + Intronic
953834150 3:46328646-46328668 ATGGAGGTGGAGAATATGGAAGG + Intergenic
953870127 3:46619112-46619134 ATGGGAGTGCAGAAGAGGGAGGG - Intronic
954161443 3:48725638-48725660 ATGGTGGTGCAGGATATGGAAGG + Intronic
954301939 3:49704907-49704929 ACGGGGCTGCAGAATTGTGAGGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956233233 3:67040313-67040335 ATGGTGGTGCAGGATATGGAAGG + Intergenic
957287060 3:78230633-78230655 GTGGGGGGGTAGAATTAGCAAGG + Intergenic
958676512 3:97274507-97274529 ATGGTGGTGCAGAATATGAAAGG + Intronic
960260177 3:115558553-115558575 ATGGGGGTGAAGAACTTGGAAGG + Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961893906 3:130151825-130151847 ATCGGGGTGCAGAGATAAGAGGG + Intergenic
961955932 3:130804141-130804163 ATGGGGCTGAAGAGTTAAGATGG - Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962523643 3:136219264-136219286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
963111585 3:141693150-141693172 ATGGTGGTGCAGGATATGGAAGG + Intergenic
963320084 3:143801844-143801866 ATGGTGGTGCAGGATGTGGAAGG - Intronic
964125172 3:153228212-153228234 ATGGTGGTGCAGAATATGAAAGG + Intergenic
964299941 3:155276499-155276521 ATGGTGGTGCAGAATATGGAAGG + Intergenic
964941351 3:162159488-162159510 ATGTGGGTGAATAATTAGGCAGG + Intergenic
965335441 3:167427151-167427173 ATGGTGGTGCAGGATATGGAAGG - Intergenic
965337410 3:167443934-167443956 ATGGGGGTACCTATTTAGGAAGG - Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
965861672 3:173157284-173157306 ATGGTGGTGCAGGATATGGAAGG + Intergenic
965945819 3:174240095-174240117 ATGGGTGTGTATAATAAGGAAGG + Intronic
966279620 3:178211918-178211940 ATGGTGGTGCAGGATATGGAAGG - Intergenic
966397331 3:179517046-179517068 ATGGTGGTGCAGGATATGGAAGG + Intergenic
969261460 4:6036790-6036812 ATGTGGGTGGAGATTTAGGAAGG - Intronic
970256134 4:14172053-14172075 ATGGTGGTGCAGAATATGAAAGG + Intergenic
970533014 4:17001846-17001868 ATGGTGGTGCAGAATATGAAAGG - Intergenic
970853771 4:20631826-20631848 ATGGTGGTGCAGAATATGAAAGG + Intergenic
971553188 4:27979493-27979515 ATGGTGGTGCAGGATATGGAAGG - Intergenic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
975152401 4:71035549-71035571 ATGGTGGTGCAGGATATGGAAGG - Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
977782172 4:100993401-100993423 ATGGTGGTGCAGGATATGGAAGG + Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
980302383 4:131011395-131011417 ATGGTGGTGCAGGATATGGAAGG - Intergenic
981482620 4:145254347-145254369 ATGGTGGTGCAGGATATGGAAGG + Intergenic
982319145 4:154060829-154060851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
982396446 4:154920384-154920406 ATGGTGGTGCAGAATATGAAAGG + Intergenic
983883443 4:172957692-172957714 ATGGTGGTGCAGGATATGGAAGG + Intronic
984412040 4:179407545-179407567 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984437579 4:179724830-179724852 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985078715 4:186243684-186243706 ATGGTGGTGCAGAATATGGAAGG + Intronic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
988199411 5:28050034-28050056 ATGGTGGTGCAGGATATGGAAGG - Intergenic
989001223 5:36762732-36762754 ATGGGGGTGCAGCATAGGGCAGG + Intergenic
989259549 5:39403797-39403819 AGGTGGGTACAAAATTAGGATGG - Intronic
990564854 5:57018680-57018702 ATGGTGGTGCAGGATATGGAAGG + Intergenic
992266948 5:75028838-75028860 ATGGAGCTGCAGAATTAAGGTGG - Exonic
992451722 5:76882002-76882024 ATGGTGGTGCAGGATATGGAAGG + Intronic
992620692 5:78589608-78589630 ATGCGGGTGCAGGTTGAGGAGGG - Intronic
994375487 5:99012890-99012912 ATGGTGGTGCAGGATATGGAAGG + Intergenic
995567895 5:113450957-113450979 ATGGGGGTGAAAAAAAAGGAGGG - Intronic
996316104 5:122162690-122162712 GTGGGGGTGCAGAGGTAGGGAGG - Intronic
996574747 5:124968442-124968464 ATGGTGGTGCAGGATATGGAAGG + Intergenic
996725495 5:126670306-126670328 ATGGTGGTGCAGGATATGGAAGG + Intergenic
996748757 5:126868490-126868512 ATGGGGATCCTGCATTAGGAAGG - Exonic
997678516 5:135733054-135733076 ATGGTGGTGCAGAATATGGAAGG + Intergenic
998447535 5:142210364-142210386 ATGGGGGTGCAAAATGCGTAGGG + Intergenic
1000438842 5:161244149-161244171 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1001353963 5:171002547-171002569 ATGGTGGTGCAGGATATGGAAGG + Intronic
1003049541 6:2766558-2766580 AAGGGGGTGCAGACTTGGGCTGG + Intronic
1003100091 6:3170416-3170438 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1003530784 6:6935989-6936011 ATAGTGGTGGAGAATTAGAAAGG - Intergenic
1003673052 6:8177625-8177647 ATGGGGTTTCAGACTTAAGAAGG + Intergenic
1005928338 6:30463248-30463270 CTGGGGGTGTGGAATTGGGAGGG - Intergenic
1006273627 6:32983546-32983568 ATATGGGTGCACAATAAGGATGG - Intergenic
1006325114 6:33347829-33347851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007161859 6:39797771-39797793 ATGAGGGTGCAGACTTCGTATGG + Intronic
1007191823 6:40025822-40025844 ATGGGAGGGGAGCATTAGGAAGG - Intergenic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1009464665 6:63954434-63954456 ATGGTGGTGCAGGATATGGAAGG - Intronic
1009749973 6:67870194-67870216 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1009751729 6:67884944-67884966 ATGGTGGTGGAGAATATGGAAGG + Intergenic
1009798159 6:68498507-68498529 ATGGTGGTGCAGAATTAGCCAGG + Intergenic
1010784652 6:79986156-79986178 ATGGGCTTGGAGAATTAGAAAGG + Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012675376 6:102106129-102106151 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1013043499 6:106460545-106460567 ATGGGGGTGGGGAATTGTGAGGG + Intergenic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1013672187 6:112416808-112416830 ATGTGAGTTGAGAATTAGGAAGG + Intergenic
1013807762 6:114013647-114013669 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1015638521 6:135304854-135304876 GTGGGGCAGCATAATTAGGAGGG + Intronic
1015801071 6:137062651-137062673 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1016751219 6:147632324-147632346 ATGGTGGTGCAGGATATGGAAGG + Intronic
1017270133 6:152494655-152494677 ATGGTGGTGCAGGATATGGAAGG - Intronic
1017357256 6:153524218-153524240 GTGAAGGTGCAGAATTGGGAAGG + Intergenic
1017922537 6:158884723-158884745 ATGGTGGTGCAGGATCTGGAAGG + Intronic
1018077880 6:160232495-160232517 ATGGTGGTGCAGGATATGGAAGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1019546455 7:1579179-1579201 GTGGTGGGGCAGAATTAGGTGGG + Intergenic
1020007247 7:4789376-4789398 ATGGGGATGCTGAATTATCAGGG - Intronic
1020350793 7:7216326-7216348 ATGGGGGAGCACATTTAAGAAGG - Intronic
1020540819 7:9459868-9459890 ATGATGGTGCAGAATATGGAAGG + Intergenic
1020794509 7:12663840-12663862 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1021172997 7:17418266-17418288 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1021430131 7:20549619-20549641 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1021660873 7:22916903-22916925 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1026977571 7:74507836-74507858 TTGGGTGTGCAGACTTAGGAGGG + Intronic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1027878718 7:83803881-83803903 ATGTGGGTGGAGGAATAGGATGG + Intergenic
1028332502 7:89611949-89611971 ATGGGGCTGAAGAAATAGGTTGG - Intergenic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1029304680 7:99610283-99610305 ATTGGGGGGCAGAATGAGGGAGG + Intergenic
1030445575 7:109644163-109644185 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1030617962 7:111757996-111758018 CTGAGGGTGCTGAAGTAGGAAGG + Intronic
1031354915 7:120778671-120778693 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1031745733 7:125495533-125495555 AGGGAGGTGCAGAATTACGAGGG - Intergenic
1031777653 7:125921963-125921985 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1033084984 7:138333046-138333068 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033088869 7:138366914-138366936 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033211780 7:139465275-139465297 ATGGTGGTGCAGGATATGGAAGG - Intronic
1033464724 7:141580145-141580167 ATGGTGGTGCAGGATATGGAAGG + Intronic
1033625842 7:143108838-143108860 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033777376 7:144627637-144627659 ATGGTGGTGCACACTTTGGAAGG + Intronic
1036472053 8:9060971-9060993 ATGGTGGTGCAGAATATGAAAGG + Intronic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1038151341 8:24944002-24944024 ATCGGTGTGGAGAACTAGGAAGG - Intergenic
1040626677 8:49157676-49157698 ATAGGGGAGCAGAGTAAGGAGGG + Intergenic
1040648320 8:49423918-49423940 ATGGCGGTGCAGGATATGGAAGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042289067 8:67148562-67148584 ATGGGAGTTCAGAATCAGGAAGG - Intronic
1043599170 8:81917839-81917861 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1043717633 8:83506749-83506771 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1043838007 8:85067107-85067129 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1044333644 8:90950189-90950211 GTGGGGGTGGAGAAAAAGGATGG + Intronic
1045533101 8:103002804-103002826 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1046075148 8:109304587-109304609 ATGGTGGTGCAGGATATGGAAGG - Intronic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048571256 8:135658950-135658972 AGGTGGGTGCAGAAGCAGGAAGG + Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049794893 8:144492749-144492771 AGGAGGGTGCAGAAAGAGGATGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053059700 9:35021336-35021358 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1056324172 9:85462827-85462849 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1057003404 9:91533805-91533827 ACGAGGGTGGAGAATTAGGTAGG + Intergenic
1057903376 9:98966327-98966349 ATGGGGGTGCAGCATTGGGTTGG - Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058784566 9:108374555-108374577 AGGTGGGGGCAGAATTAGGTGGG + Intergenic
1059343921 9:113615646-113615668 ATGGGGGACCAGAATCAGAAAGG + Intergenic
1059909365 9:119025392-119025414 GTAGGGGTGCAGGATTAGGGAGG - Intergenic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060264183 9:122100880-122100902 ATGGGTGTGCAGAAGTGGAAAGG - Intergenic
1060824896 9:126682344-126682366 ATGGGGCTGCAGCTTTAGAAGGG - Intronic
1060927216 9:127463393-127463415 ATGGGGGTTCAGAATTATCCAGG + Intronic
1061347755 9:130041174-130041196 TTGAGGGTGCAGAAGTGGGAAGG - Intronic
1062692305 9:137848661-137848683 ATGGTGGTGCAGGATATGGAAGG - Intronic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186317026 X:8382080-8382102 GTGGGGTTGCAGAACTAGGTGGG + Intergenic
1187787171 X:22904852-22904874 TTGAGGGTGCTGAATTTGGAAGG + Intergenic
1188332724 X:28894149-28894171 ATGGTGGTGCAGGATATGGAAGG + Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1190936261 X:55001292-55001314 GTGGAGGTGGAGAATTAGGTGGG - Intronic
1191013913 X:55790022-55790044 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1191761625 X:64653456-64653478 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1192326541 X:70137148-70137170 ATGGGGGAGTACATTTAGGAGGG + Intronic
1192706441 X:73531856-73531878 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1192731218 X:73804283-73804305 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1193537395 X:82731226-82731248 ATGGTGGTGCAGCATATGGAAGG - Intergenic
1194661001 X:96628421-96628443 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1194873480 X:99160774-99160796 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1195326586 X:103763400-103763422 ATGGTGGTGCAGAATATAGAAGG + Intergenic
1196063750 X:111440017-111440039 ATGGGGTTGGTGAATTAGGGTGG + Intergenic
1196083582 X:111659740-111659762 CTGGGGGTGTGGAATTAGGGTGG - Intergenic
1197500031 X:127230976-127230998 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1197871468 X:131066336-131066358 ATGGAGGTGAAGAATCAGGGTGG - Intronic
1198388331 X:136148324-136148346 GGTGGGGTGCAGAATAAGGAGGG + Intronic
1198437370 X:136630372-136630394 ATGGGGCTGAACAATTAGAAGGG - Intergenic
1198966242 X:142230948-142230970 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1200813154 Y:7505124-7505146 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1201233969 Y:11892446-11892468 ATGGTGGTGCAGGATGTGGAAGG + Intergenic
1202076207 Y:21040245-21040267 ATGGTAGTGCAGAATATGGAAGG + Intergenic