ID: 911118837

View in Genome Browser
Species Human (GRCh38)
Location 1:94274786-94274808
Sequence AAACAGCAACAGCTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 350}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911118828_911118837 12 Left 911118828 1:94274751-94274773 CCACCACCCAGCTCCACTCTCCA No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118827_911118837 13 Left 911118827 1:94274750-94274772 CCCACCACCCAGCTCCACTCTCC No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118831_911118837 6 Left 911118831 1:94274757-94274779 CCCAGCTCCACTCTCCAGGAGCA 0: 1
1: 0
2: 3
3: 30
4: 340
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118826_911118837 26 Left 911118826 1:94274737-94274759 CCAACTCTCTGCTCCCACCACCC 0: 1
1: 0
2: 7
3: 95
4: 1007
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118834_911118837 -1 Left 911118834 1:94274764-94274786 CCACTCTCCAGGAGCAAAGGTTA No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118835_911118837 -8 Left 911118835 1:94274771-94274793 CCAGGAGCAAAGGTTAAACAGCA No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118830_911118837 9 Left 911118830 1:94274754-94274776 CCACCCAGCTCCACTCTCCAGGA No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350
911118832_911118837 5 Left 911118832 1:94274758-94274780 CCAGCTCCACTCTCCAGGAGCAA No data
Right 911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 40
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911118837 Original CRISPR AAACAGCAACAGCTGGAGCA TGG Intronic
900100920 1:961686-961708 AAACTGCACCAGCTGGTCCAAGG - Exonic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
901474397 1:9479600-9479622 TGACACCAACAGCTGGAGGAGGG + Intergenic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
904172821 1:28603601-28603623 ATACAGCAGCAGCTGGAGTCAGG + Intronic
904721181 1:32509866-32509888 AAAGTGCAACACCTGGTGCAGGG - Intronic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
905457504 1:38098311-38098333 AACCAGCAGAAGCTGGAGCCCGG - Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906177475 1:43787234-43787256 AGCCAGGAACAGCTGGAGCCTGG + Intronic
907060365 1:51416369-51416391 AGATAGCAGCAGCTGAAGCATGG + Intronic
907583193 1:55590483-55590505 AAGAAGCAGCAGCTGCAGCAAGG - Intergenic
907865303 1:58393701-58393723 AAACACCACAGGCTGGAGCAGGG + Intronic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
910519497 1:88103202-88103224 AAACAAATACAGTTGGAGCATGG - Intergenic
911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG + Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913129573 1:115827638-115827660 CAGCAGCAACAGCTGGATAATGG + Intergenic
913958180 1:143321566-143321588 CAACAGCAAGGGCAGGAGCAGGG + Intergenic
914052495 1:144146941-144146963 CAACAGCAAGGGCAGGAGCAGGG + Intergenic
914126702 1:144819600-144819622 CAACAGCAAGGGCAGGAGCAGGG - Intergenic
914454093 1:147819318-147819340 GAACAGAAGCAGCTGCAGCAGGG + Intergenic
915008131 1:152659562-152659584 AAAGAGCAACACCAGGAGTATGG - Intergenic
915509351 1:156378082-156378104 AAACAGCACCACCTCCAGCAGGG - Exonic
916322611 1:163521839-163521861 AAACAGCACAAGATGCAGCAGGG - Intergenic
916880622 1:169016686-169016708 AAACAGAAACATGTGGAGCCAGG + Intergenic
917457906 1:175201382-175201404 CAACAGCAACAGCAGGAAAAGGG - Intergenic
918198291 1:182243084-182243106 AAACAGCATCGGCTGGATCTTGG + Intergenic
918605969 1:186426343-186426365 ACACAGCATCACGTGGAGCAGGG - Intergenic
919866661 1:201788012-201788034 AAAAAGCACCAGCTAGAGAAGGG - Intronic
921289395 1:213642237-213642259 AAACAGCAGTAGGTGGACCAGGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921777642 1:219120780-219120802 AATCAGAAACAGATGGTGCAAGG - Intergenic
922473654 1:225891242-225891264 AGACAGCAACAACTCAAGCATGG + Intronic
1064092498 10:12396729-12396751 AACCAGCAACAGCTGCTGCGGGG - Intronic
1065453181 10:25880004-25880026 GAGCAGCATCAGCTGGAGGAAGG + Intergenic
1067399001 10:45953681-45953703 AAACAGTAAAAGCTGAGGCAAGG - Intergenic
1067582412 10:47454011-47454033 AAGCAGCAACTTCTGGTGCAAGG + Intergenic
1067701047 10:48572490-48572512 ATACAGCAATAGGTGAAGCAGGG - Intronic
1068070710 10:52191316-52191338 AAAAAAAAATAGCTGGAGCATGG - Intronic
1068469108 10:57437379-57437401 AAACAGCAAACGCTGGGGAAAGG + Intergenic
1068610831 10:59058208-59058230 AAAAAGTAACAGCTGTGGCATGG - Intergenic
1071251812 10:83826542-83826564 AAACTCCAAAAGCTGAAGCATGG - Intergenic
1075331943 10:121580373-121580395 AAGCAGCAGCAGCTGGAGACTGG + Intronic
1075599036 10:123753639-123753661 ACTCAGCAACAGCAGGAACAAGG - Intronic
1075972984 10:126671072-126671094 AAGCAGCAACAGCTGCAAGAGGG + Intergenic
1076346751 10:129784689-129784711 AAACTGCATCAGCTGGAGCTGGG + Intergenic
1077670726 11:4154795-4154817 GAACAGCATGAGCAGGAGCAGGG + Intergenic
1077974620 11:7234930-7234952 AAACAGCAAGTGCTGGGGGAAGG + Intergenic
1080230800 11:30016637-30016659 AAGCTGCAACAGCTGGAGGAGGG + Exonic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083802396 11:65054056-65054078 AAACAGCAGCAGCTGTTTCACGG + Intronic
1083925124 11:65801455-65801477 AGACAGCAAGACCTGCAGCAAGG + Intergenic
1084760225 11:71266172-71266194 AATCAGCAACAGATGGATGACGG - Intergenic
1086071427 11:82803780-82803802 AAACAGCAAAATGTGGAGTATGG + Intergenic
1088000423 11:104873504-104873526 AAACAAAAAGAGCTGGAGAATGG + Intergenic
1089002860 11:115066900-115066922 ATGCTGCAACAGCTGGAGCCAGG + Intergenic
1089100705 11:115959757-115959779 GGACAGCACCAGCTGGAGGAGGG - Intergenic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089733144 11:120532095-120532117 AGACAGCCACAGCTGGAGCCGGG + Intronic
1090157389 11:124455242-124455264 ATACAGCAACAACAGGAGAAGGG + Intergenic
1091084304 11:132705640-132705662 ACACGGCAAAAGCAGGAGCAAGG - Intronic
1091277391 11:134361842-134361864 AAGCAGCAACAGCAGGTGCCGGG - Intronic
1091355258 11:134932989-134933011 AAATAGCAAGCACTGGAGCAGGG - Intergenic
1092233222 12:6789453-6789475 AAACGTCACCAGCTGGAGCTGGG - Exonic
1093259622 12:16918744-16918766 ACACAGCTACTGCTGGAGTAAGG + Intergenic
1094047840 12:26186871-26186893 AAACAATTACAGCTGAAGCAAGG - Intronic
1094199375 12:27780677-27780699 GGACAGCAGCAGCTGCAGCAGGG - Exonic
1095053244 12:37572867-37572889 AATCAGAGACAGCTAGAGCAAGG + Intergenic
1095096122 12:38150265-38150287 AATCAGCTCAAGCTGGAGCAGGG - Intergenic
1096521722 12:52188281-52188303 ATACAGTAGCAGCTGTAGCAGGG + Intronic
1096588066 12:52636667-52636689 CAACAGCAACAGCAACAGCACGG + Intergenic
1099045386 12:77711321-77711343 AGACAGCAAAAGGTGGGGCAGGG - Intergenic
1100393496 12:94164411-94164433 ATGCCGCAAAAGCTGGAGCATGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1102474602 12:113180549-113180571 AATCAGTAGCAGCTGGAGCAAGG - Intronic
1103000786 12:117383921-117383943 AAATAGAAACAGCTCCAGCACGG - Intronic
1103210379 12:119161653-119161675 AGACAGCAGCACCTGGAGCTGGG - Exonic
1103850522 12:123930001-123930023 ATACAGCAACAGCTGAGGCAAGG - Exonic
1103932415 12:124457739-124457761 AAACAGGAACATGTGGCGCAGGG + Intronic
1104096000 12:125558799-125558821 AAACAGTAATTGCTGGAGAAAGG - Intronic
1104644170 12:130485352-130485374 TAAAAGCCACAGCTGGAACATGG + Intronic
1104689169 12:130812016-130812038 AATCAGCAAAATCTGCAGCATGG + Intronic
1104958496 12:132477209-132477231 AAACCGCAGCAGCTGCAGCAGGG - Intergenic
1106784221 13:33091073-33091095 ACACAGCAACAGCTGCTGCTTGG - Intergenic
1107765609 13:43730937-43730959 AAAGAGCAGCAGCTGCTGCAGGG - Intronic
1109201546 13:59436930-59436952 AGAAAGAAACAGCTGGAGTATGG + Intergenic
1109906462 13:68847792-68847814 AAACAGCAGTAGTAGGAGCAAGG - Intergenic
1110281581 13:73699792-73699814 AAACAGCACCTGGTAGAGCAAGG + Intronic
1110531005 13:76597974-76597996 AAACAGAAGCAGATGGATCAGGG + Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111643935 13:91006264-91006286 AAACGGAAAGAGCTGGAGAAGGG - Intergenic
1113404487 13:110025590-110025612 AAACAGTTCCAGCTGAAGCAAGG + Intergenic
1114059565 14:19007063-19007085 AAGCAGCAAGATCAGGAGCAGGG + Intergenic
1114102981 14:19394688-19394710 AAGCAGCAAGATCAGGAGCAGGG - Intergenic
1117067644 14:52026328-52026350 ACACAGCAACACCAGGAGCAGGG + Intronic
1117081290 14:52154797-52154819 AAAAGGCAGCAGCTGGAGGAGGG + Intergenic
1117636693 14:57752356-57752378 AATCAGCTGGAGCTGGAGCAAGG - Intronic
1118933949 14:70269028-70269050 AACCTGCAGCAGCTGGAGAATGG + Intergenic
1119330009 14:73786865-73786887 AAACAGCAAGGGCTGCAGCGGGG - Intronic
1119896263 14:78222271-78222293 AGAGAGCAGCTGCTGGAGCAGGG + Intergenic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1123003462 14:105309470-105309492 AAACAGCAACACCTACAGAAAGG - Exonic
1123192615 14:106585785-106585807 AGACAGCAGCAGCTGGTGCCCGG - Intergenic
1124011367 15:25842046-25842068 CAACAGCAACAGGTGGCCCAGGG - Intronic
1124122320 15:26898545-26898567 AAGCAGCAACATCTGTAGGATGG + Intronic
1125336377 15:38630554-38630576 AAAGAGCAACAGCTGGTTGATGG - Intergenic
1126011403 15:44305753-44305775 TAACAGCAACCCATGGAGCAAGG - Intronic
1126259305 15:46669226-46669248 AAACAAAAGGAGCTGGAGCAAGG + Intergenic
1126462512 15:48928463-48928485 AAACGGAAACAGCTGGAACAAGG + Intronic
1127057872 15:55150954-55150976 AAACCACAGCAGCTGCAGCAAGG - Intergenic
1127733846 15:61823677-61823699 TCACAGCAACATCTGGACCAGGG - Intergenic
1129912273 15:79238259-79238281 AAATTGCAACAGCTGGAAAATGG + Intergenic
1130892149 15:88142309-88142331 ATACAGCAGCAGCTGCTGCAAGG + Intronic
1132311959 15:100863803-100863825 AAACAGCAACTGTCGGGGCAGGG + Intergenic
1133079156 16:3305130-3305152 GCCCAGCAACAGCTCGAGCACGG + Intronic
1133281857 16:4671192-4671214 AACCAGCAGCACCTGGAACAGGG - Intronic
1133812900 16:9174955-9174977 AAACAGCAACAGCAGATGGATGG - Intergenic
1134191910 16:12128204-12128226 TAACAGCCCCAGCTGGAGCATGG - Intronic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1137501620 16:49015651-49015673 AGACAGCAACAGCTGCGGAATGG + Intergenic
1137649897 16:50110764-50110786 AGACAGCCACAGCTGAAGGAAGG + Intergenic
1138346415 16:56322994-56323016 ATACAGCACCAGCTGTACCATGG + Intronic
1139254294 16:65526558-65526580 AAACAGCAAAATCTGTCGCAGGG - Intergenic
1140520856 16:75580282-75580304 AAACAGCCCCATTTGGAGCAGGG + Intergenic
1141209166 16:81960004-81960026 ACACAGCAGCAGCTGGAGAGAGG - Exonic
1141471145 16:84239531-84239553 AAACAGCTCCTTCTGGAGCACGG + Intronic
1142858445 17:2746665-2746687 AAAAACAAACAGCTGAAGCAGGG - Intergenic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143466616 17:7141156-7141178 CAACTGCATCAGCTGGACCATGG + Intergenic
1143900290 17:10169416-10169438 AAACAGCATAAACTGTAGCATGG - Intronic
1146637612 17:34518013-34518035 AAAAAGGGACAGCTTGAGCATGG - Intergenic
1147894961 17:43744451-43744473 AGACAGCAACAGAAGGACCAGGG + Intergenic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1149842217 17:59975373-59975395 AAACACCAACAGGCTGAGCACGG + Intergenic
1150665725 17:67135402-67135424 AAGAAGCAACAACTAGAGCAGGG - Intronic
1152105036 17:78323884-78323906 AAAGAACAACATCTGGAGCCGGG - Intergenic
1152388322 17:79988349-79988371 AATCAGCCACAGCTGGAGCCAGG - Intronic
1153665797 18:7366954-7366976 CCACAGCAGCAGCTGGAACAGGG - Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1158620327 18:59027277-59027299 AAAAAGGGACAGCTGGAGCTGGG - Intergenic
1160933307 19:1580952-1580974 AAACAGAAACAGCCAGGGCAAGG - Intronic
1161421086 19:4176207-4176229 AAACAGGAACAATTGGAGCATGG + Intronic
1162061305 19:8097110-8097132 AAGCAGCCAGAGCTGGAGTAAGG + Intronic
1163266155 19:16223759-16223781 AGACAGCAGCAGGTGGACCAGGG - Intronic
1163649248 19:18507590-18507612 AACCAGCAACAGCCAGATCATGG - Intronic
1164634297 19:29781264-29781286 GAACAGCACCTGCTGGAGCCCGG - Intergenic
1165569691 19:36765143-36765165 AATCAGAGACAGCTAGAGCAAGG - Intronic
1166098166 19:40554546-40554568 AAACACCTGCAGCTGGAGCAAGG + Exonic
1166738594 19:45100758-45100780 AAACAGAAACAGGTGGGGTAAGG + Intronic
1166863803 19:45824261-45824283 AAGCAGCAGCAGGTGGAGCCTGG - Intronic
1167641176 19:50682598-50682620 AAACAGAAACACCTGGGGTATGG + Intronic
1167853394 19:52219139-52219161 ACACAGCAAGGGCTGGAGCTGGG + Intronic
1202691893 1_KI270712v1_random:99365-99387 CAACAGCAAGGGCAGGAGCAGGG + Intergenic
925470290 2:4153713-4153735 AAACAGCAGCAGCAGCAGCCTGG - Intergenic
925985816 2:9213801-9213823 AGACAGCAACAGCTTCACCATGG - Intronic
927498155 2:23564340-23564362 AGAAAACAACAGCTGGGGCAAGG + Intronic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928552317 2:32384677-32384699 AATCAGCAACAGCTGTAGCCTGG + Intronic
929265941 2:39919825-39919847 AGACAGCAGCAGCAGCAGCAAGG + Intergenic
929297325 2:40263152-40263174 AACCAGCAAATGGTGGAGCATGG - Intronic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
930989914 2:57640820-57640842 AAACGTCAACTGCTGGAGCAGGG + Intergenic
931233128 2:60390944-60390966 ATACAGGAACAGCTGGATCCAGG - Intergenic
933279530 2:80317647-80317669 AAACAGCAACAGATGGTAGAAGG - Intronic
934030861 2:88045403-88045425 AAACAGCAACACATGCAACACGG + Intronic
935346900 2:102116707-102116729 AAACAGCAACAGCAGCAGGAAGG + Intronic
937211854 2:120278832-120278854 GCACAGAAACAGCGGGAGCAGGG - Intronic
937454502 2:122029668-122029690 AAACAGCAGTTGGTGGAGCAGGG - Intergenic
938090523 2:128429030-128429052 AAACAACAACAAATGGATCATGG - Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
943045359 2:182854618-182854640 TAACAGCAACGGCTGCAACAAGG + Intronic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943607920 2:189997772-189997794 AAACAGGAACTGCTGCAGAAAGG - Intronic
943647039 2:190417644-190417666 AGACAGCAACAGATGGCACAGGG - Intronic
944043687 2:195384383-195384405 ACACAGCGAAAGCAGGAGCAAGG + Intergenic
945675204 2:212847406-212847428 AAACACCAAGAGCTGGAGGAAGG - Intergenic
945966153 2:216189295-216189317 AAACAGCCACAGCTAGTGAATGG + Intronic
947314024 2:228835578-228835600 AGACAGCAGCAGCAGCAGCAAGG - Intergenic
948319993 2:237061451-237061473 AACCACAAACACCTGGAGCACGG + Intergenic
948322144 2:237078969-237078991 AGACAGCAAGAGCAAGAGCAGGG - Intergenic
1168981296 20:2006185-2006207 AAACTGATACAGCTGGGGCAAGG + Intergenic
1170346564 20:15393357-15393379 AAACAAAAACATCTGGAGAAAGG - Intronic
1170395202 20:15918706-15918728 TTACAGCAACAGCTTGAGAAAGG - Intronic
1170987834 20:21274576-21274598 AAACAGAATCAGGTGTAGCATGG + Intergenic
1171529032 20:25839518-25839540 AATCAGAGACAGCTAGAGCAAGG - Intronic
1171547794 20:26016367-26016389 AATCAGAGACAGCTAGAGCAAGG + Intergenic
1172931628 20:38590801-38590823 AAAGCTCATCAGCTGGAGCAAGG - Intergenic
1174531727 20:51219753-51219775 AAACAGCAATGGCTTGAGCTAGG + Intergenic
1174657870 20:52186815-52186837 TCACAGGTACAGCTGGAGCATGG - Exonic
1174843511 20:53921508-53921530 AAGCAACAACAGCTGGAGCTGGG + Intergenic
1175498916 20:59435499-59435521 AAACAGCACCAGGTGGGGAAGGG - Intergenic
1176233149 20:64042124-64042146 AGTCAGCCACAGCTGGAGCAGGG - Intronic
1177084301 21:16682719-16682741 TAACAGAAAATGCTGGAGCATGG + Intergenic
1177162269 21:17560456-17560478 ACACAGCCTCAGCTGGAGCAGGG - Intronic
1177649764 21:23945641-23945663 AAAAAATAACAGTTGGAGCACGG + Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1179158486 21:38872814-38872836 AACCAGCAGCAGTTGGAGGAGGG - Intergenic
1181768066 22:25106152-25106174 AAAGGGCAACAACTGGGGCAGGG + Intronic
1182453357 22:30434140-30434162 AGCCAGCAAGAGCTGGAGCTGGG - Intergenic
1183222228 22:36522836-36522858 AAAAAGCAGAAGCGGGAGCAGGG - Intronic
1183598965 22:38828997-38829019 AAACAGGGACTTCTGGAGCAGGG + Intronic
1183685412 22:39358802-39358824 AGACGGCATCAGCTGGAGCCTGG + Intronic
1183715460 22:39530754-39530776 CAACAAAAACAGCTGGAGTAGGG + Intronic
1184918868 22:47591526-47591548 AAACAGCATCAGCTGCACCAAGG - Intergenic
950540141 3:13607567-13607589 AAACAGCAGCAGTGGCAGCAAGG - Intronic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
950788769 3:15456034-15456056 ACACAGCATTAACTGGAGCATGG + Intronic
950940495 3:16885463-16885485 TAACAGGAACCACTGGAGCATGG + Intronic
952133695 3:30393516-30393538 GAACAGCAAGAGCTGAAGCTGGG + Intergenic
952265129 3:31778029-31778051 AAACAGGAAATGCTGGAGGAAGG + Intronic
953159285 3:40403504-40403526 AAAGAGCAAGATCTTGAGCAAGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953428588 3:42817637-42817659 AGAGAGCAATAGCTGGAGAAAGG - Intronic
955548768 3:60059965-60059987 AAACAACAACTCATGGAGCACGG - Intronic
956401466 3:68884278-68884300 GAAACGCAACAGCTGGAGCCTGG + Intronic
957595547 3:82260391-82260413 AAACAGCAACATCTGGCTGAAGG + Intergenic
958023601 3:88025605-88025627 CAATAGCAACAGCAGAAGCAAGG + Intergenic
959598084 3:108149331-108149353 CCACAGCAAAAGCAGGAGCAAGG - Intergenic
959910522 3:111758576-111758598 ACACTGCACCAGCTGAAGCAGGG - Intronic
960166570 3:114409490-114409512 AAACAGAAGCAGCTGAAGGAAGG + Intronic
960779811 3:121307160-121307182 AAACAGCAAAAACTGGAGAGGGG + Intronic
961728231 3:128947076-128947098 AAAAAGGAACGGCTGGAGCAGGG + Intronic
962328280 3:134454275-134454297 AAGCAGCAACAGCAACAGCATGG - Intergenic
963838219 3:150078763-150078785 AAATACAAACTGCTGGAGCAGGG + Intergenic
964484246 3:157171277-157171299 AAAGAGAACCAGCTGGAGAATGG + Intergenic
964732923 3:159886333-159886355 AAACAGCACCAGCTGAAGCTCGG + Intronic
965400392 3:168206264-168206286 ATAGAACAAAAGCTGGAGCAGGG - Intergenic
966033183 3:175376820-175376842 AAACAACCCCAGCTGAAGCATGG - Intronic
966192743 3:177286237-177286259 AAATAGCAACAGCCTGAACAAGG + Intergenic
966621203 3:181966121-181966143 AAACAGTAAGAGGTGGGGCAGGG + Intergenic
967125410 3:186418963-186418985 AAACAGCAACAGCAGAGGTAAGG + Intergenic
967131183 3:186471999-186472021 AGACAGCAAAGGCTGGAGCTTGG + Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
967742730 3:193021123-193021145 AAAAAGCAGCAGCAGCAGCATGG - Intergenic
968376629 4:48316-48338 GAAAAGCAACAGCTGGATTAAGG - Intergenic
968418763 4:464782-464804 AAAAAGCAGCAGCTGGGGCTGGG + Intronic
970098248 4:12489358-12489380 AAACAGTAACAGCATAAGCATGG - Intergenic
972368111 4:38394806-38394828 AAACAGTAATGGATGGAGCAGGG - Intergenic
972705340 4:41537379-41537401 AAAAAGCAACAGGTGGAAAATGG + Intronic
972866794 4:43242918-43242940 AAACAGCATGAGCTGAAGCATGG - Intergenic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
974498333 4:62662859-62662881 AATCAGCAAAATTTGGAGCAGGG - Intergenic
976551153 4:86396716-86396738 ACATAGCAAATGCTGGAGCAAGG + Intronic
976887410 4:90002651-90002673 AAAAAGCAATAGCTGGATGAAGG + Intergenic
977145400 4:93433584-93433606 AAAGAGCAAGAGCTTGAGCATGG - Intronic
978887995 4:113788541-113788563 GGACAACAACAGCTGTAGCAAGG + Intergenic
979384083 4:120043089-120043111 AAACAGCAAAACCTGAAGAAGGG + Intergenic
979967774 4:127096400-127096422 ACACCGCAAGAGCAGGAGCAAGG + Intergenic
980655746 4:135783039-135783061 TGTCAGCAACAGCTGGAACAAGG - Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
984034553 4:174649258-174649280 AAACAGAAGCTGCTTGAGCAGGG + Intronic
984988639 4:185355921-185355943 AGCCAGTATCAGCTGGAGCAGGG + Intronic
985391227 4:189492325-189492347 AAACACCAACAACTGGAGTGGGG - Intergenic
986590580 5:9365216-9365238 AAACAACCAGGGCTGGAGCAAGG + Intronic
987812002 5:22849088-22849110 CTACAGCCACAGCTGGAACATGG - Intronic
988306260 5:29498476-29498498 TAGCAGCTACAGCTGCAGCAAGG + Intergenic
989430972 5:41355079-41355101 AAAGAGGAACAACTGGAGAAAGG - Intronic
990237240 5:53781392-53781414 GAACAGAAACAGGTGGGGCAAGG - Intergenic
990538378 5:56747120-56747142 AAGAAGCAACAGCTGGAGTAGGG + Intergenic
990659009 5:57991644-57991666 AAACAGCGAGAGCTTGAGCTAGG + Intergenic
990876134 5:60488307-60488329 ACGCAGCTACACCTGGAGCAAGG + Intronic
992397616 5:76382137-76382159 AAACCACAAAAGCTGGAGTATGG - Intergenic
993634254 5:90325567-90325589 AAACACCATCTGCTGGATCATGG - Intergenic
994150327 5:96440384-96440406 AAACAGCTACAGCTGCAGCGTGG - Intergenic
994203819 5:97009680-97009702 AAATAGCAGCAGCAGCAGCAAGG - Intronic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
995270770 5:110217474-110217496 AAAGAGCATGAGCTGAAGCAGGG - Intergenic
996318990 5:122192697-122192719 TCAGAGGAACAGCTGGAGCAGGG + Intergenic
998151788 5:139761722-139761744 AAACAGCACCAGATGGAGGCCGG - Intergenic
998355638 5:141533694-141533716 AAAAAGCAAAAGTGGGAGCAAGG + Intronic
1001046848 5:168380313-168380335 ATACAGAATCAGCTGGGGCATGG + Intronic
1001096517 5:168779673-168779695 AAAAAGCTAGAGCTGGAGGAGGG + Intronic
1002647093 5:180664127-180664149 AAACAGCAAACCCTGGAGAAAGG - Intergenic
1003340671 6:5217447-5217469 AAACAGTAGAAGCTGGAGCAAGG - Intronic
1003361431 6:5429829-5429851 AAACAACAAGAGCAAGAGCAGGG + Intronic
1004058200 6:12162547-12162569 AAACAGCCAGAGGTAGAGCAGGG - Intronic
1007288925 6:40769504-40769526 AACCAATAACAACTGGAGCAGGG - Intergenic
1007970188 6:46044217-46044239 AAAAAGCCTCAACTGGAGCAAGG - Intronic
1009908759 6:69901546-69901568 AAACAGCGGCAGCTGTAGCGTGG - Intronic
1010393849 6:75368191-75368213 AAACTGCACCAGGTGGAACAAGG + Intronic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1016597784 6:145820942-145820964 AAACAGCACACGCTGGGGCAGGG - Intergenic
1016700374 6:147047698-147047720 ACATAGCGAGAGCTGGAGCAAGG - Intergenic
1017258122 6:152357499-152357521 AAACAGCAGAAGATGGAGGAAGG - Intronic
1017658987 6:156655679-156655701 AAACAGCAACAGCTGCTCCTGGG - Intergenic
1017873734 6:158506567-158506589 AAACTGCATCACCTGGAGGAGGG - Exonic
1018029441 6:159830476-159830498 CAATAGCAAGAGCTGGGGCAGGG - Intergenic
1018091552 6:160349956-160349978 CAACAGCAACAGCGGCAGAAAGG - Intronic
1018726290 6:166615651-166615673 AAACAGCAAAAGCAAGAGCTGGG + Intronic
1018745545 6:166758917-166758939 AAATAGCAACCACTGGAGAAAGG - Intronic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019274024 7:166531-166553 GAACAGGAACAGCTGGGGAAAGG + Intergenic
1022275160 7:28847753-28847775 AAGCTGCATCAGCTGGAGCTGGG + Intergenic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023057817 7:36303867-36303889 TACCAGGAACAGCTGGAGCCTGG - Intergenic
1023528989 7:41134001-41134023 AAACAGCACCACCAGGAGCAGGG - Intergenic
1023969550 7:44980836-44980858 AACCAGCAGCAGCTAAAGCAAGG - Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1028634517 7:92972236-92972258 AAATAGCAAAAGCAGGAGCAAGG + Intergenic
1028834997 7:95365222-95365244 AAATAGCAGCAGCTGGAACAAGG - Intronic
1030452684 7:109732173-109732195 AAACAGAAAGAGCTTGTGCAGGG + Intergenic
1031922665 7:127613216-127613238 AGAGAGCAAAAGCTAGAGCAGGG - Intronic
1032926166 7:136607716-136607738 AAACAAAAAAAGCTGGAGGAAGG + Intergenic
1034096091 7:148409194-148409216 AAAGAGAAACAGCAGGAACAGGG + Intronic
1035660309 8:1342919-1342941 AAAGAGAAACAGCTGGTGCCTGG - Intergenic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1038501618 8:28049612-28049634 AAACAGCTACAGCTAGAGGTAGG + Intronic
1039100362 8:33934954-33934976 CAACAGCAACAGCAGCACCAGGG - Intergenic
1041084536 8:54244618-54244640 AAAAAGTAAAAGCTGGAGAAAGG + Intergenic
1041182841 8:55266348-55266370 AGACAGAGACAGCTGGAGGATGG - Intronic
1041361710 8:57061607-57061629 AAACAGAACCAGGTGGGGCACGG - Intergenic
1041735170 8:61103299-61103321 AAACAGCAGCATTTGGAGTAGGG - Intronic
1042836885 8:73087105-73087127 AAACACCAACAGAGTGAGCAAGG - Intronic
1043603819 8:81974561-81974583 AAACAGCAACAGAGGAAGAAAGG - Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044493893 8:92853168-92853190 AAAAAGCAGGAGCTGGAGAAGGG - Intergenic
1045060382 8:98405803-98405825 AAACAGAGACAGCTTGTGCAGGG + Intronic
1045147650 8:99365430-99365452 AAACAGCAAAAGCAGGACTAAGG - Intronic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1046628657 8:116602064-116602086 AAACAGCAGCAGCTGTGCCAGGG - Intergenic
1047016767 8:120731785-120731807 ATACAGCAACAGCTGGGGTCTGG - Intronic
1047690744 8:127351970-127351992 AAACAGTGACAGCTGAAGCTGGG + Intergenic
1047876848 8:129148120-129148142 AAACAGCAACTGATGGGGCAGGG - Intergenic
1049124813 8:140777327-140777349 ACACAGCAAAAGCAAGAGCAAGG + Intronic
1049349086 8:142154485-142154507 AAGCAGCTCCAGCTGGACCATGG - Intergenic
1049458622 8:142709473-142709495 AAACAGCCACAGGTGTGGCAGGG - Intergenic
1049913047 9:288375-288397 ACACAGCAAGTGGTGGAGCAGGG - Intronic
1050591473 9:7164607-7164629 AAACAGGAGCACCTGCAGCACGG - Intergenic
1051134348 9:13901373-13901395 AAGTAGCAACTGCTGGAGCGAGG + Intergenic
1051237138 9:15013297-15013319 AAAAAGAAACAGCTGGGGCAGGG - Intergenic
1051476607 9:17515784-17515806 ATAGAGCAACAGCTGAAGCAGGG - Intergenic
1051980982 9:23016079-23016101 AAACAGCTACAGCTGGATCAAGG - Intergenic
1052431460 9:28371928-28371950 AAGCAGAAAGTGCTGGAGCAAGG + Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053370259 9:37555204-37555226 AACCAGCAACAGCCTGGGCATGG - Intronic
1053797009 9:41735752-41735774 AATCAGAGACAGCTAGAGCAAGG - Intergenic
1054148184 9:61579116-61579138 AATCAGAGACAGCTAGAGCAAGG + Intergenic
1054185422 9:61947834-61947856 AATCAGAGACAGCTAGAGCAAGG - Intergenic
1054467928 9:65510212-65510234 AATCAGAGACAGCTAGAGCAAGG + Intergenic
1054653087 9:67640664-67640686 AATCAGAGACAGCTAGAGCAAGG + Intergenic
1055241609 9:74192967-74192989 AAACAGCACAAGCTGGAGATAGG - Intergenic
1055731585 9:79283962-79283984 AACCAGCAACAGGTTGTGCAGGG + Intergenic
1056052492 9:82784042-82784064 AAAAAGCGACAGAGGGAGCACGG - Intergenic
1056581052 9:87888229-87888251 AACCAGCTTCAGCTGGAGAAGGG + Exonic
1056935863 9:90914380-90914402 ATCCAGCAACAACTGCAGCATGG + Intergenic
1057222922 9:93267479-93267501 AACCAGCTCCAGCTGGGGCAGGG + Intronic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1059050573 9:110920185-110920207 AGGCAGCAACAGCTCTAGCATGG + Intronic
1059440427 9:114303733-114303755 AAACAGCAAAAGCTGAGGCCTGG - Intronic
1059484211 9:114614492-114614514 AAACAGCAGCAGCTACAGAATGG - Intronic
1059779321 9:117509288-117509310 AAACAGCATCAGCTGTACCAGGG - Intergenic
1060673756 9:125493870-125493892 AAACAGTACAAGCTGGAGCTAGG + Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1203572601 Un_KI270744v1:145830-145852 GAAAAGCAACAGCTGGATTAAGG + Intergenic
1185742146 X:2542245-2542267 AAACAGGAACATCTGGTGAAAGG - Intergenic
1186362102 X:8852940-8852962 AATGAGCAACAGATGGGGCAAGG - Intergenic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1186495871 X:10012866-10012888 AAAAAGCATCAGGTAGAGCAAGG - Intergenic
1187158187 X:16740629-16740651 ACACAGCAAGAGCTGGAGAGAGG - Intronic
1187505601 X:19875868-19875890 AAGAAGCAGCAGCTGGAGCTAGG - Intronic
1188626764 X:32294623-32294645 AAAAAGCAAAAACTGGGGCAGGG + Intronic
1188873938 X:35406761-35406783 AAACAGTAAAAATTGGAGCAGGG - Intergenic
1189637059 X:43022695-43022717 AAAGAGCGAGAGCTTGAGCAGGG + Intergenic
1190342142 X:49305429-49305451 AACCAGCAACACCTGAAGAAGGG + Exonic
1190344393 X:49323768-49323790 AACCAGCAACACCTGAAGAAGGG + Exonic
1190345483 X:49333312-49333334 AACCAGCAACACCTGAAGAAGGG + Exonic
1190346585 X:49342878-49342900 AACCAGCAACACCTGAAGAAGGG + Exonic
1190347833 X:49533906-49533928 AACCAGCAACACCTGAAGAAGGG + Exonic
1190348934 X:49543462-49543484 AACCAGCAACACCTGAAGAAGGG + Exonic
1190350036 X:49553018-49553040 AACCAGCAACACCTGAAGAAGGG + Exonic
1190351139 X:49562571-49562593 AACCAGCAACACCTGAAGAAGGG + Exonic
1190352240 X:49572129-49572151 AACCAGCAACACCTGAAGAAGGG + Exonic
1190353341 X:49581678-49581700 AACCAGCAACACCTGAAGAAGGG + Exonic
1190354445 X:49591222-49591244 AACCAGCAACACCTGAAGAAGGG + Exonic
1190355546 X:49600749-49600771 AACCAGCAACACCTGAAGAAGGG + Exonic
1190797271 X:53757472-53757494 ACACAGCAGCAGCTGGAACCTGG - Intergenic
1190913069 X:54789610-54789632 ACACAGCAGCAGCTGGAACCTGG - Intronic
1191225742 X:58040913-58040935 CAACAGCAACAGTAGCAGCATGG - Intergenic
1191884081 X:65872019-65872041 AAACACCACCAGGTGGAGCCAGG + Intergenic
1191921981 X:66266664-66266686 AAACAGTAACATCTGGAGCCTGG + Exonic
1193099873 X:77597788-77597810 AAACAGCAGATGCTGGAGAAGGG + Intronic
1194945337 X:100060007-100060029 TAACAGGAAGAGCTGGAGAATGG + Intergenic
1195821681 X:108951932-108951954 ATACAAAAACAGCTTGAGCAAGG - Intergenic
1197960740 X:132003433-132003455 AAAAAGCAACAGCTGTAACTTGG - Intergenic
1198162803 X:134024237-134024259 AAACAGGAACAGGAGGAGCAGGG + Intergenic
1199296005 X:146159522-146159544 AAACTGCAAAAGTTAGAGCATGG + Intergenic
1201713517 Y:17017932-17017954 AAACAACAACAGCTGTAGGCAGG + Intergenic