ID: 911119152

View in Genome Browser
Species Human (GRCh38)
Location 1:94277760-94277782
Sequence CTTCCTCCCATCACTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911119152_911119154 -6 Left 911119152 1:94277760-94277782 CCTGACACAGTGATGGGAGGAAG No data
Right 911119154 1:94277777-94277799 AGGAAGAAAGGAAGAAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911119152 Original CRISPR CTTCCTCCCATCACTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr