ID: 911125156

View in Genome Browser
Species Human (GRCh38)
Location 1:94334530-94334552
Sequence AGGGAAACTACCACCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911125156 Original CRISPR AGGGAAACTACCACCTTGGA AGG Intergenic
901223841 1:7600630-7600652 AGGGACACAAACACTTTGGAAGG - Intronic
903212309 1:21824934-21824956 AGGGAGCCTATGACCTTGGATGG + Exonic
905527219 1:38648159-38648181 AGGGACACAAACACCGTGGAGGG + Intergenic
907157158 1:52345164-52345186 AAGGAAACCAGCTCCTTGGAAGG - Intronic
908011534 1:59783070-59783092 AGAGAAAATAGCACCTGGGAGGG + Intergenic
909706582 1:78592115-78592137 AAGGAAACCACACCCTTGGATGG - Intergenic
909970238 1:81975525-81975547 AGGGGAAATACCATGTTGGATGG + Intronic
910229848 1:84974540-84974562 AGGGAACCTACTGCCTTGAAGGG + Intronic
910871443 1:91836895-91836917 ATGGAAACTGCCACAGTGGAGGG - Intronic
911125156 1:94334530-94334552 AGGGAAACTACCACCTTGGAAGG + Intergenic
912191854 1:107349921-107349943 AGGGAAATAAATACCTTGGAAGG + Intronic
913088769 1:115461910-115461932 AGGGAAACCAAGACCTTAGAGGG - Intergenic
917240067 1:172938636-172938658 ATGGAAATTCCCAACTTGGAAGG + Intergenic
918166625 1:181955316-181955338 AGGGACACAAACACTTTGGAAGG + Intergenic
919336704 1:196244768-196244790 AGGGAACTTACCACCCTGAAGGG + Intronic
921437570 1:215143537-215143559 ATGGAAACAACCACCTTATAGGG - Intronic
921892300 1:220365816-220365838 AGGAAAACTGCCACCTTGACTGG - Intergenic
922320833 1:224485211-224485233 AGAAAAGCTACCATCTTGGAAGG - Intronic
922358144 1:224795917-224795939 AGGGAATCTACTGCCTTGAAAGG - Intergenic
924451794 1:244185097-244185119 AGTGAAACAAGCACCTTTGAGGG - Intergenic
1067158877 10:43806050-43806072 AGGCAAACTACCACTTAGGGGGG - Intergenic
1068108670 10:52652452-52652474 AGAAAAACTGCCACTTTGGATGG + Intergenic
1070019291 10:72568067-72568089 AGGGAGACTTCAACCTAGGAGGG + Intronic
1070947677 10:80407165-80407187 AGGCAAATGACCACCTTTGACGG + Intergenic
1072419941 10:95281746-95281768 TGTGAAACTAGCACTTTGGAAGG - Intronic
1072734039 10:97867221-97867243 AGGCAAACTCCCTCCTTGCAAGG + Exonic
1075812498 10:125235176-125235198 AGGGTCACCAACACCTTGGAGGG + Intergenic
1077427414 11:2489777-2489799 AGGGAATCCACTGCCTTGGAGGG + Intronic
1078235169 11:9477709-9477731 GGGGAAAAAACCACCATGGAGGG + Intronic
1078464416 11:11539627-11539649 AGGGAAACTGCCCACTTGGGAGG + Intronic
1080932701 11:36829359-36829381 AGGGAAACTACCATCAGAGAAGG - Intergenic
1083079070 11:60072664-60072686 AGGGACACAAACACCTCGGAAGG - Intergenic
1083090933 11:60200438-60200460 AGGGACACAAACACCTCGGAAGG - Intergenic
1087299277 11:96413525-96413547 AGGGAACCCACTACCTTGAAGGG + Intronic
1087874471 11:103339413-103339435 AGGGAATCTACAACCCTGGTGGG - Intronic
1089762232 11:120736177-120736199 AGGGAACCTGCTACCTTGAAGGG - Intronic
1089898267 11:121954314-121954336 AAGGAAACTAAAAACTTGGATGG - Intergenic
1090418776 11:126559065-126559087 AGGGAAACTACCCCTGGGGAAGG + Intronic
1094090646 12:26645329-26645351 AGGAAACCTACCACTGTGGATGG + Intronic
1095529575 12:43170713-43170735 AGGGATACTGCCACCTTGGGAGG + Intergenic
1096502654 12:52074304-52074326 AGGGACACTCCCATCTTGGATGG - Intronic
1099491355 12:83292436-83292458 AGGGAACCTACTACCTCGAAGGG + Intergenic
1105308142 13:19183240-19183262 AGGGAGCCTCCCACCTTGGCTGG + Intronic
1106262790 13:28082596-28082618 AGGGATCCTCCAACCTTGGAAGG + Intronic
1107413306 13:40177443-40177465 AGGGCAACTGTCACCTTGCAGGG + Intergenic
1108816736 13:54301656-54301678 AGGGAATCTGCTACCTTGGTAGG - Intergenic
1109031725 13:57199344-57199366 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1113000706 13:105632397-105632419 AGGAAAAATACCAGGTTGGAAGG + Intergenic
1113462428 13:110491503-110491525 AGAGAAACAACCACCTGGGCTGG + Intronic
1114387902 14:22274058-22274080 AGGGAAACTACCACCCCTGTTGG + Intergenic
1116765919 14:49070486-49070508 AGGGAACCTACTGCCTTGAAGGG + Intergenic
1116889039 14:50249557-50249579 AGGGAACCTACTGCCTTGGAGGG + Intronic
1117384293 14:55195258-55195280 AGGGAACCTACTGCCTTGAAAGG - Intergenic
1117679054 14:58184651-58184673 ATGGAAATTACTTCCTTGGAGGG + Intronic
1117795455 14:59388806-59388828 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1120808109 14:88775016-88775038 AGGGAAACTGCTGCCTTGAAGGG + Intronic
1123926780 15:25121218-25121240 AGGGAAAACACCACCTTGATAGG + Intergenic
1126440512 15:48683405-48683427 AGGGAACCCACCACCTTGAAAGG + Intergenic
1128153064 15:65375578-65375600 AAGTAAAGTACCGCCTTGGATGG - Intronic
1128898738 15:71399469-71399491 AAGGAAACTTCCTCCTTGCAAGG + Intronic
1129917996 15:79291722-79291744 AGGAAAACTACCACCATTCAAGG - Intergenic
1137405409 16:48185064-48185086 AGGTAAAATAACACCATGGAAGG + Intronic
1139122948 16:64042800-64042822 AGGGAACCTACTGCCTTGAAGGG + Intergenic
1139340009 16:66262408-66262430 AGGGACACTCCCACCTGTGAAGG + Intergenic
1142523315 17:519963-519985 AGGAAAACTACCACCACGGGAGG + Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1147815811 17:43209415-43209437 TGGGAAATTACAACCTGGGAAGG - Intronic
1150192617 17:63259067-63259089 AGGGAACCTGCTACCTTGAAAGG - Intronic
1150302207 17:64055993-64056015 AGGGAAACAAGCAGCTGGGAAGG + Intronic
1150409322 17:64930299-64930321 AGGGACACAACCACTGTGGAAGG + Intergenic
1155924956 18:31646001-31646023 ATGGATACAACCACCTTGGGAGG - Intronic
1157022674 18:43805534-43805556 AGGGAACCCACTACCTTGAAGGG - Intergenic
1160957812 19:1701715-1701737 AGGGACACTCCAACCTGGGAGGG - Intergenic
1162666802 19:12220420-12220442 AGGGAACCTACCGCCTTGAAGGG - Intergenic
1165159130 19:33805623-33805645 AGAGAAGCTGCCACCTTGGCAGG + Intronic
1166308003 19:41946100-41946122 AGGGATCCTCCCACCTTGGCGGG + Intergenic
1167092513 19:47354291-47354313 ATGCAAACTGCCATCTTGGAAGG + Intronic
1167738128 19:51310095-51310117 AGGGAATTTTCCACCTTGCAGGG + Intergenic
925288384 2:2730480-2730502 GGGGCAACTCCCACCATGGAGGG - Intergenic
928312302 2:30221035-30221057 AGAGAAACAACCAGCGTGGATGG + Intergenic
931161972 2:59702593-59702615 AGGGAACCCACAACCTTGAAGGG - Intergenic
932217927 2:69978731-69978753 CGGGCTGCTACCACCTTGGAGGG - Intergenic
937512481 2:122611659-122611681 AGGGAAACTGCTACCTTAAAGGG + Intergenic
938457264 2:131474755-131474777 AGGGATCCTCCCACCTTGGCTGG - Intronic
939244841 2:139610088-139610110 AGGAAAACTACTACCTTGAAGGG - Intergenic
939338608 2:140863648-140863670 AGGCAAATTACTAACTTGGAGGG - Intronic
939365879 2:141230691-141230713 AGGGAAGCTGCCACCTCAGAGGG + Intronic
939570574 2:143835906-143835928 AGGAAAACAACTGCCTTGGAAGG - Intergenic
945061617 2:205914088-205914110 AGGGAAACTAGCAGAGTGGAAGG - Intergenic
945210206 2:207374994-207375016 AGGGAAACTGCTGCCTTGAAGGG + Intergenic
946773274 2:223111380-223111402 AGGGAAACTGCCTCCCTGGAAGG + Intronic
947312377 2:228818423-228818445 AGGGAAACCACTGCCTTGAAGGG - Intergenic
1170311553 20:14997668-14997690 AGGGAACCTGCCACCCTGAAGGG + Intronic
1173721119 20:45259031-45259053 AGTCATCCTACCACCTTGGATGG - Intergenic
1176994982 21:15544505-15544527 AGGGAATCTACTGCCTTGCAGGG + Intergenic
1177222259 21:18209767-18209789 AGGGAACCTACTGCCTTGAAGGG - Intronic
1177275995 21:18913632-18913654 AGGGAAACCACTGCCTTGAAGGG - Intergenic
1179108086 21:38421534-38421556 AGGGAAAGTCACACCATGGAGGG + Intronic
1181623301 22:24105615-24105637 AGGGAAACAGGCACCCTGGATGG - Intronic
1183238155 22:36635780-36635802 TGGGAAAAGACCACATTGGAGGG - Intronic
950429773 3:12944084-12944106 AGGGAAACTGGGACCTTGAAGGG - Intronic
951443127 3:22745828-22745850 AGGTAAAATACCACCATGGGTGG + Intergenic
952105175 3:30061232-30061254 AGGGAAATTACCAAGTTAGAGGG + Intergenic
952639755 3:35579489-35579511 AGGGAACCCACTGCCTTGGAAGG + Intergenic
952672997 3:35993741-35993763 AGGGAACCTACTGCCTTGAAGGG + Intergenic
955759071 3:62258822-62258844 TGGGAAACTACTCCCTGGGAAGG - Intronic
955877758 3:63511257-63511279 AGAGAAACTACCTACTTGGAGGG - Intronic
956431957 3:69195869-69195891 GGGGAAGCTACCACATTTGAGGG + Intronic
957533534 3:81471445-81471467 AGGGAAAGTGCCATCTTGAATGG + Intergenic
959263946 3:104114219-104114241 AAGGTAACTACCCCCTGGGATGG + Intergenic
959474323 3:106790740-106790762 AGGGAACCTGCTACCTTGAAGGG + Intergenic
960974509 3:123161505-123161527 AGGGAAACTTCCACTGAGGAGGG + Intronic
963154096 3:142077581-142077603 AGGGAACCTACTGCCTTGAAGGG + Intronic
966328997 3:178790163-178790185 AGGGAACCTACTGCCTTGAAGGG + Intronic
968096291 3:195932990-195933012 AGGGAACCTGCCACCCTGAAAGG + Intergenic
969243443 4:5916966-5916988 AGGGAAACTTCCAACTTCTAGGG - Intronic
969671922 4:8594381-8594403 AGGGAATCTTCCACCAGGGAAGG - Intronic
970441836 4:16086643-16086665 AGGGAAACTGCTGCCTTGAAGGG + Intergenic
972271111 4:37511443-37511465 AAGGAACCTACTACCTTGAAGGG - Intronic
972579161 4:40379721-40379743 AGGGAACCCACTACCTTGAATGG + Intergenic
976101482 4:81568484-81568506 AAAGAAACTACCACTTTGGCAGG - Intronic
976779552 4:88743751-88743773 AGGCAAACTCTCAGCTTGGAAGG - Intronic
977307431 4:95342415-95342437 AGCAAAACTACTACCTTGAAGGG + Intronic
978922453 4:114200874-114200896 AGGGAACCTACTGCCTTGGAGGG - Intergenic
979463991 4:121015612-121015634 ATGCAAAATAACACCTTGGAAGG + Intergenic
982755448 4:159213158-159213180 AAGGAAACAAGCAACTTGGACGG - Intronic
986085127 5:4437381-4437403 AGGGAACCTACTACCCTGAAAGG - Intergenic
986963378 5:13242113-13242135 ATGGAAACTTCCACCCTGCAGGG - Intergenic
987496604 5:18653054-18653076 AGGAAACCCACTACCTTGGAGGG - Intergenic
989321664 5:40142065-40142087 AGGGAAATTCCCACTTTGAAAGG - Intergenic
991107492 5:62861177-62861199 AGGGAACCTGCTACCTTGAAAGG - Intergenic
991195319 5:63925212-63925234 TTGGAAACTTCCACCTTTGAGGG - Intergenic
994292919 5:98051085-98051107 AGGGAACCCACTGCCTTGGAGGG + Intergenic
994771405 5:103986256-103986278 AGGGAAACTATAACCTTTTATGG - Intergenic
997206519 5:132053542-132053564 AGGGAAGCTGCCACCTGGGCTGG - Intergenic
998032324 5:138881502-138881524 AGGGAAACTAGCAGCTTTTAGGG - Intronic
998689414 5:144570822-144570844 AGGGAAACCATCTCCTTGAAAGG - Intergenic
1000385408 5:160670512-160670534 CTGGAAACTGCCAGCTTGGATGG - Exonic
1006424562 6:33956120-33956142 AAGGAAGCTACCCCCTGGGATGG - Intergenic
1008962157 6:57277015-57277037 AAGGAGAAGACCACCTTGGAAGG + Intergenic
1009748282 6:67848270-67848292 AGGGAAACTGCTTCCTTGAAGGG + Intergenic
1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG + Intergenic
1013695015 6:112691914-112691936 AGGGAAACTATCTCACTGGAGGG + Intergenic
1016025999 6:139287643-139287665 AGGGAAAGTATCACATAGGAGGG + Intronic
1016760882 6:147735686-147735708 AGTGAAACTCCCTCCTTGAATGG - Intronic
1018207064 6:161445845-161445867 AAGGAAACCACCACCCTGCAAGG - Intronic
1019490539 7:1311223-1311245 ACGGAAACAACCACCCTGAAAGG - Intergenic
1021399447 7:20192963-20192985 AGGGAACTTTCCACCTTGAAGGG - Intronic
1021545982 7:21813163-21813185 ATGGAAACAACAACTTTGGATGG - Intronic
1022416203 7:30179241-30179263 AGGGGAAGTAACACCTTGTAAGG + Intergenic
1022898413 7:34776805-34776827 AGGGAAACTACTGCCTTGAAGGG - Intronic
1024973391 7:55091329-55091351 ATGAAAACTACCATCTTGAAAGG + Intronic
1026595955 7:71734347-71734369 AGGGAATCTATGAGCTTGGATGG - Intergenic
1029647885 7:101869577-101869599 AGGGAAACCAGCACGTTAGAAGG + Intronic
1030222419 7:107110671-107110693 AGGGAACCTACTGCCTTGAAGGG + Intronic
1030761859 7:113362143-113362165 AGGGAAGCCACTACCTTGGGGGG + Intergenic
1032010011 7:128339701-128339723 AAGGAGATTACCACCTTTGAAGG - Exonic
1032972006 7:137175144-137175166 AGAAAACCTACCACCTTGAAGGG + Intergenic
1033424106 7:141227752-141227774 AGGGCAACTACCACCTTAGCAGG - Intronic
1033768477 7:144521969-144521991 AGGGAAACTGGCACCTAGGCTGG + Intronic
1034581823 7:152050354-152050376 AGGGAACCTGCTACCTTGAACGG - Intronic
1035378582 7:158423958-158423980 AAGGTAATTACCACCTTAGAGGG - Intronic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1045778327 8:105833463-105833485 AGGGTAACTGCCAAATTGGATGG + Intergenic
1047933604 8:129753401-129753423 AGGGAACCTACTGCCTTGAAGGG + Intronic
1047938001 8:129800612-129800634 AGGGAAACTGCTGCCTTGAAAGG - Intergenic
1048246369 8:132806408-132806430 AGAGAAAATCCCACCGTGGAAGG - Intronic
1050617313 9:7415720-7415742 AGTGAAACCACCATTTTGGAAGG - Intergenic
1051039081 9:12784769-12784791 AGGGAACTCACCACCTTGAAGGG - Intronic
1052409286 9:28102280-28102302 TGGGAAACTAGTAACTTGGAAGG + Intronic
1053746922 9:41208347-41208369 AGGGGAACTACCAGCATGAAAGG - Intergenic
1054480363 9:65657012-65657034 AGGGGAACTACCAGCATGAAAGG + Intergenic
1054681422 9:68222934-68222956 AGGGGAACTACCAGCATGAAAGG + Intergenic
1055886504 9:81069656-81069678 AGGGAACCTACTGCCTTGAAGGG - Intergenic
1055923590 9:81488204-81488226 AGGGAACCTAGCACCCTGGAAGG + Intergenic
1056220287 9:84445183-84445205 AGGGAAAAGACCACCTTGTCTGG + Intergenic
1058279413 9:103093387-103093409 AGTCATACTCCCACCTTGGAAGG - Intergenic
1061522649 9:131129369-131129391 AGACAAACTGCCACCATGGAGGG - Exonic
1202783053 9_KI270718v1_random:19127-19149 AGGGGAACTACCAGCATGAAAGG - Intergenic
1186182513 X:6986737-6986759 AGGGAAACTTGCATCCTGGAGGG + Intergenic
1186958657 X:14710945-14710967 ATGGAACATACCACCTTGGAAGG - Intronic
1187132733 X:16518181-16518203 AGGGAATCCACTACCTTGAAGGG + Intergenic
1187385577 X:18845628-18845650 ACGGAAACTATCACCTTTGATGG + Intergenic
1187618072 X:21020261-21020283 AGGGAACCTGCTACCTTGAAGGG + Intergenic
1187636797 X:21238188-21238210 AGGGAATCTGCCACCTTCAAGGG + Intergenic
1192062134 X:67838634-67838656 AGGGAAGCTACTGCCTTGAACGG + Intergenic
1192304469 X:69944415-69944437 AGGGAACCTGCCGCCTTGAAGGG - Intronic
1192393316 X:70753496-70753518 AGGGAACCCACTACCTTGAAGGG + Intronic
1193272772 X:79548107-79548129 AAGGAAACTTCCACCATAGAAGG + Intergenic
1193411351 X:81167130-81167152 ATAGAAACTATCCCCTTGGAGGG + Intronic
1193585049 X:83311165-83311187 AGGGAACCTACTTCCTTGAAGGG + Intergenic
1193596445 X:83451684-83451706 AGGGAACCTACTGCCTTGAAGGG - Intergenic
1193830968 X:86289125-86289147 AGGGAAACTTCTGCCTTGAAGGG - Intronic
1193856753 X:86612095-86612117 AGGGAACCCACTACCTTGAAGGG - Intronic
1194526561 X:94984079-94984101 AGGGAACTTGCCACCCTGGAGGG + Intergenic
1195108290 X:101621437-101621459 TGGGAAACCACAACCTTAGAAGG + Intergenic
1195601362 X:106752124-106752146 AGGGACACCACCACCCTGAAGGG + Intronic
1197025020 X:121738075-121738097 GGGGAGACTACCACCTGGAAGGG + Intergenic
1197602654 X:128548312-128548334 AGGGAACCTACTACCTTAAAGGG - Intergenic
1197810877 X:130441929-130441951 AGGGAACCTGCTACCTTGAAGGG - Intergenic
1198515288 X:137400779-137400801 AGGGAACCTGCTACCTTGAAAGG - Intergenic
1198724704 X:139664916-139664938 AGGGAACCTACTGCCTTGAAGGG - Intronic
1199037008 X:143063683-143063705 AGAGAACCTACTACCTTGAAAGG + Intergenic
1199374218 X:147088240-147088262 AGGGAGACTACTACCCTGAAGGG - Intergenic
1199485064 X:148338304-148338326 AGGGAATCTACTGCCTTGAAGGG + Intergenic
1199795487 X:151191623-151191645 AGGGAATCTACTGCCTTGAATGG + Intergenic