ID: 911126169

View in Genome Browser
Species Human (GRCh38)
Location 1:94343130-94343152
Sequence CACTCCAAAGAGAAGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911126169_911126174 8 Left 911126169 1:94343130-94343152 CCCGCTCCCTTCTCTTTGGAGTG No data
Right 911126174 1:94343161-94343183 TTCTAGAGCTGATCCACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911126169 Original CRISPR CACTCCAAAGAGAAGGGAGC GGG (reversed) Intergenic
No off target data available for this crispr