ID: 911131389

View in Genome Browser
Species Human (GRCh38)
Location 1:94391944-94391966
Sequence TCTGCCACACAGAAAACGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911131384_911131389 26 Left 911131384 1:94391895-94391917 CCTGATTTGTTGTGGGAGGAGAC No data
Right 911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG No data
911131386_911131389 4 Left 911131386 1:94391917-94391939 CCAATCAGAGGTTCTTTCAATTT No data
Right 911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG No data
911131382_911131389 30 Left 911131382 1:94391891-94391913 CCAGCCTGATTTGTTGTGGGAGG No data
Right 911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911131389 Original CRISPR TCTGCCACACAGAAAACGGT GGG Intergenic
No off target data available for this crispr