ID: 911138094

View in Genome Browser
Species Human (GRCh38)
Location 1:94464689-94464711
Sequence ATGTTGACTTAGATGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911138094 Original CRISPR ATGTTGACTTAGATGAAACA TGG Intronic
900675494 1:3882874-3882896 ATGTATACGTAGATGAAACGTGG + Intronic
901393927 1:8966772-8966794 TTGTTGACATGAATGAAACAAGG + Intronic
902884648 1:19396011-19396033 AGGATGACTTAGGTGGAACACGG - Intronic
903434898 1:23341502-23341524 ATGTTGAACTAGAGAAAACAGGG - Intronic
903671553 1:25038901-25038923 AGGTTGAATGAGATGAATCAAGG - Intergenic
904147589 1:28406143-28406165 ATGTTTACTTAAGTGAAGCAAGG + Intronic
904147988 1:28410448-28410470 ATGTTTACTTAAGTGAAGCAAGG - Intronic
906253446 1:44329437-44329459 CTGATGAGTGAGATGAAACATGG - Intronic
909812496 1:79947916-79947938 ATTTTGATTTAGATGAAGTAAGG + Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
911427397 1:97736113-97736135 ATATGGACTTAGATAAATCATGG + Intronic
911927266 1:103850144-103850166 ATGTCAACTTAGATAAAACATGG + Intergenic
912026719 1:105184388-105184410 ATCTTGACTTAGAGGCAAAATGG + Intergenic
913382207 1:118224651-118224673 ATGTTTACTTATTTGAGACAGGG - Intergenic
916804901 1:168249964-168249986 ATATTGAATGAGATAAAACATGG - Exonic
917523114 1:175764288-175764310 ATGTGTACTTTGATGAACCAAGG + Intergenic
918503950 1:185230540-185230562 ATGTTACCTTATTTGAAACAGGG - Intronic
918985044 1:191614277-191614299 ATGGTGGCTTAGATGAAGGAAGG + Intergenic
919029971 1:192228832-192228854 ATGTTAACTTATATGTACCATGG + Intergenic
919124930 1:193382259-193382281 TTGTTTGGTTAGATGAAACATGG - Intergenic
922600561 1:226848611-226848633 ATTTTGTCCTAGCTGAAACATGG + Intergenic
923544957 1:234917448-234917470 ATGTTGAATTACCTGAAACTAGG - Intergenic
923810802 1:237313287-237313309 ATGTTGCCTTATATGACAAAAGG + Intronic
924398558 1:243651875-243651897 ATTTTGACTTTGGTGAAACCTGG - Intronic
1063595256 10:7429337-7429359 ATGTTTCTTTAGATGACACAGGG - Intergenic
1065377847 10:25061017-25061039 ATGTTTCTTTAGATGAGACAAGG + Intronic
1065765071 10:29021425-29021447 ATGTTCACTGTAATGAAACAGGG - Intergenic
1068301521 10:55148167-55148189 ATGTTGAAGTACAAGAAACAGGG - Intronic
1068453475 10:57224168-57224190 ATTTTGACTTAGAAGTAAAAAGG + Intergenic
1069342135 10:67423372-67423394 ATATTGACATAGAAGAAAGAGGG + Intronic
1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG + Intronic
1073926232 10:108519553-108519575 ATGTGGAGTTAATTGAAACATGG + Intergenic
1074496843 10:113986958-113986980 ATGGTGACATGGATGAAACCTGG - Intergenic
1074731785 10:116385975-116385997 CTGTTTACTTAGCTGAAAAATGG + Intergenic
1078032131 11:7763647-7763669 ATGAAGGCTTAGATGATACATGG + Intergenic
1079065366 11:17286345-17286367 ATTTTGACTTGGTTGAGACAGGG + Intronic
1082612319 11:55315883-55315905 ATGTTTACTTATAAAAAACAGGG - Intergenic
1085807936 11:79653627-79653649 ATTTGGAATTAGATCAAACAGGG + Intergenic
1086357530 11:86019367-86019389 GTATTGACTTAGTTGAATCAAGG - Intronic
1086503971 11:87482963-87482985 CTGGTGACTTCTATGAAACATGG - Intergenic
1086822824 11:91455964-91455986 ATGTTTATTGAGATGAAAAAAGG + Intergenic
1087926978 11:103930038-103930060 ATGTAGACTGGGATGAAATAAGG - Intronic
1088732336 11:112694329-112694351 ATGTTGACTGGGATGAACCTGGG + Intergenic
1091030349 11:132181536-132181558 AGGTTGACTTAACAGAAACAAGG + Intronic
1092294667 12:7188972-7188994 ATGTTGACTTAGCGGAAGGAAGG + Intronic
1092319008 12:7451539-7451561 CTGTTTACTTTGAGGAAACAAGG - Intronic
1092702394 12:11246739-11246761 ATGTTAACTTACATGACAAAAGG + Intergenic
1092711972 12:11348447-11348469 ATGTTAACTTACATGACAAAGGG + Intergenic
1096593746 12:52680347-52680369 ATGTTGACTTAGAGAAAAGTAGG + Exonic
1098392398 12:69983250-69983272 AAGTTGACTTAAAGGAAATAAGG + Intergenic
1099508930 12:83509634-83509656 CTGTTGACTTAGAGGAAAAGAGG - Intergenic
1099706878 12:86165907-86165929 ATGTTGACATTGATGAAGCCAGG - Intronic
1102157652 12:110743434-110743456 ATTTTGACTTATCTGAAAGAGGG - Intergenic
1102482038 12:113230594-113230616 AAGGTGACTAAGATAAAACAAGG - Intronic
1103042939 12:117710839-117710861 AGGTCGACATGGATGAAACATGG - Intronic
1103887148 12:124210994-124211016 AGGATGACTTAAATGAAAGAGGG + Intronic
1104424428 12:128663359-128663381 ATGTTGTGTGAGGTGAAACAAGG - Intronic
1105492154 13:20899309-20899331 ATGTTGACTAAGAACCAACATGG + Intronic
1106684404 13:32042813-32042835 AAATTGACTTAGATGAATCATGG + Intronic
1107734720 13:43386610-43386632 TTGTTGACTTGGATGTAAAATGG + Intronic
1107905732 13:45059398-45059420 ATGTTGATTAAAATTAAACATGG - Intergenic
1107977987 13:45708182-45708204 ATGTTGACATGAATGAATCAGGG - Intronic
1109356191 13:61231783-61231805 ATGTTGACTTAGCCTAAAGAGGG - Intergenic
1109783645 13:67146105-67146127 ATGTTGACTGAAATGAAACGTGG - Intronic
1109844218 13:67963413-67963435 ATGATAACTTAGATGCAATAAGG + Intergenic
1109888602 13:68576824-68576846 ATGTTGATTTCTATTAAACATGG + Intergenic
1110282999 13:73717371-73717393 CTATGGAATTAGATGAAACATGG + Intronic
1111005883 13:82248246-82248268 ATGTTAACTCACATGACACAAGG - Intergenic
1111708033 13:91775814-91775836 ATTCTCACTTAGATGAAACCTGG - Intronic
1112032483 13:95470522-95470544 ACTTTGACTTAGAAGAAAAAGGG - Intronic
1112723806 13:102278467-102278489 CTGATGAGGTAGATGAAACAGGG + Intronic
1113589455 13:111488265-111488287 ATGGTTTCTTAGATGAAGCAGGG + Intergenic
1117598376 14:57346949-57346971 TTGTTCACTTAGATGACACAGGG + Intergenic
1117738557 14:58791985-58792007 ATGTTGACTTACAAGAAAAAAGG + Intergenic
1119942316 14:78654356-78654378 AAGTTGTCCTAAATGAAACAAGG + Intronic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1128258827 15:66217691-66217713 ATGAAGGATTAGATGAAACAAGG - Intronic
1128969438 15:72094396-72094418 CTGTTGACTTACTTGACACAGGG - Intronic
1130522180 15:84671709-84671731 ATGTTGACCTTGAGGATACAGGG - Intronic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1134875363 16:17693387-17693409 ATATTGACTTATTTGAAATAGGG - Intergenic
1141867241 16:86758969-86758991 GTGTTGAATCAGATGAAACTAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146814893 17:35934789-35934811 ATGCCGCCTGAGATGAAACAGGG - Exonic
1147235322 17:39052919-39052941 ATGCTGCCCGAGATGAAACAGGG + Intergenic
1149428414 17:56577433-56577455 AGGGTGAGTTAGATGCAACATGG - Intergenic
1151271867 17:73003033-73003055 ATGTTACCTTATATGAAAGAAGG - Intronic
1155005015 18:21720991-21721013 GTGTGGATTGAGATGAAACAAGG + Intronic
1155244728 18:23896547-23896569 ATGTATACTTAGATGGAATATGG + Intronic
1156591735 18:38497411-38497433 GTGTGGTCTTAGATAAAACAGGG + Intergenic
1157521792 18:48350516-48350538 ATGTTGCCTTATGTGACACAGGG - Intronic
1158033390 18:52994395-52994417 AAGTTGCCTTAAATTAAACAAGG + Intronic
1159125975 18:64225193-64225215 ATGTTGCCTTGGATGAAATTAGG - Intergenic
1159969457 18:74631333-74631355 GTATTGCATTAGATGAAACAGGG + Exonic
1164715254 19:30386096-30386118 ATGTTGCCTGAGATGAAGCTGGG - Intronic
1166177440 19:41084659-41084681 ATGTTGACATGTATGCAACATGG + Intergenic
926261193 2:11263928-11263950 ATATTGAGTTAGATAAAAAATGG - Intronic
927814678 2:26204472-26204494 ATGTTGACTTAAATGTAAACTGG - Intronic
929913950 2:46118036-46118058 ATGCTGAATTACATAAAACAAGG + Intronic
932555307 2:72818600-72818622 GTGGTCACTTAGATTAAACAAGG - Intronic
935334565 2:102004461-102004483 ATGTTGAATGTGGTGAAACATGG + Intronic
937292471 2:120790072-120790094 ATGTTGACTCAGAGGAAGAAGGG - Intronic
940510747 2:154611227-154611249 ATGTTGACTTAGAGGACAGAAGG - Intergenic
941413693 2:165192180-165192202 ATTTTGATTTAGATTAAATAAGG - Intronic
943010052 2:182436691-182436713 ATGTAGAATTAACTGAAACAGGG - Intronic
944080373 2:195781314-195781336 ATGTAGACATAGATGAGATATGG + Intronic
946270727 2:218591101-218591123 ATGTTACCTTAAATGAAAAATGG - Intronic
1175723111 20:61299512-61299534 ATGTTGACTTAGATGTTTCTTGG + Intronic
1176704872 21:10107595-10107617 ATTTCTACTTTGATGAAACATGG - Intergenic
1177265366 21:18776338-18776360 ATTTTTACTTAGAGGAAAAATGG + Intergenic
1177689285 21:24482955-24482977 ACTTTGACTTAGATGGAAGAAGG - Intergenic
1179200217 21:39211321-39211343 ATGTTGCCTTACATGAGAAAAGG + Intronic
1179530479 21:42015192-42015214 ATGTTACCTTATATGAAAAAAGG - Intergenic
1180065664 21:45410997-45411019 CTGTTGTCTAAGTTGAAACATGG - Intronic
1182161474 22:28126546-28126568 ATGTTGATTTAGATGGAAAAAGG + Intronic
1182163435 22:28147122-28147144 TTGTTGAATTAGATGAAAGCTGG - Intronic
950223256 3:11212778-11212800 GTTTTGACTTTGATGAAACAGGG - Intronic
952704646 3:36365121-36365143 ATGTTGACGTAGATTAATCAAGG + Intergenic
953487912 3:43319722-43319744 ATGTTAACAGAGATGAACCAAGG + Intronic
954294839 3:49668531-49668553 ATGTTGACTTAGAAGCAATAGGG + Exonic
955191285 3:56763936-56763958 ATATTAACTAAGAAGAAACACGG + Intronic
955338895 3:58109561-58109583 ATGTTGACCTAGAGAAGACATGG - Exonic
958067358 3:88560540-88560562 CTGTTGAATTAGATGACACATGG - Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
960067998 3:113395738-113395760 ATAATGACTTACATGAGACATGG + Exonic
960206822 3:114912027-114912049 ATGTTCACTTATATGGAACAAGG - Intronic
964568837 3:158090179-158090201 ATGTTGGCTTACATGACAAAGGG - Intergenic
967652048 3:191997881-191997903 AAGTTGAGTGAGATGAAAGATGG - Intergenic
967841010 3:194004410-194004432 ATGTCCACTTAGAAGAAACCAGG + Intergenic
970257147 4:14180280-14180302 AAGATGACATAGATGACACATGG - Intergenic
970879804 4:20915634-20915656 ATGTTGTCTAATGTGAAACAAGG + Intronic
970965315 4:21921646-21921668 ATGTGGACTGAGAGGAAAGAAGG - Intronic
971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG + Intergenic
971110931 4:23585166-23585188 ATTTTCTCTTGGATGAAACAAGG + Intergenic
971603102 4:28621371-28621393 ATGTAGCCTTAGAGTAAACATGG - Intergenic
971987241 4:33842205-33842227 ATATTAACATAGATGAAATATGG - Intergenic
972370941 4:38422767-38422789 ATGTTGAATTAAATGCAATATGG - Intergenic
973093530 4:46167588-46167610 CTGATGACTTTGATGAAATAGGG + Intergenic
973176428 4:47211984-47212006 ATGTTACCTTATATGAAAAAAGG - Intronic
974703009 4:65475381-65475403 AAGTTCACTTAGAGGAAAGAAGG - Intronic
975956580 4:79847966-79847988 ATGTTGACTGAGATAATGCATGG + Intergenic
975960457 4:79897737-79897759 ATGTTGCTTTGGATGAAACCAGG - Intergenic
976364142 4:84214318-84214340 ATGGTGGCTTAGATGAGGCAAGG + Intergenic
976950067 4:90817717-90817739 AATTTTACTTAGAGGAAACATGG + Intronic
977095376 4:92736034-92736056 ATGTTAACTTACATGACAAAAGG + Intronic
977354080 4:95923842-95923864 ATTTTGACTTGGATAACACATGG - Intergenic
978032117 4:103947978-103948000 ATTTTGTCTTAGCTGAAATATGG + Intergenic
978456829 4:108902781-108902803 ATGTTGACTTAGAATAATGATGG + Intronic
979150298 4:117304798-117304820 ATGTTGCCTTATATGACAGAAGG - Intergenic
980267234 4:130533019-130533041 ATTTAGAATTTGATGAAACACGG + Intergenic
980377094 4:131964026-131964048 ATTTCTACTTTGATGAAACATGG - Intergenic
981292455 4:143091602-143091624 ATTTTGTCTTAGCTGAAATATGG + Intergenic
984070755 4:175109145-175109167 ATGTTGTCTGAGAAGAAAAAAGG + Intergenic
984533151 4:180942946-180942968 ATGTTGGCTTCTGTGAAACATGG + Intergenic
984726811 4:183029551-183029573 ATGGTGGCTTAAATGAAGCATGG + Intergenic
985956907 5:3272520-3272542 AGGGGGACTTAGATGAAACACGG - Intergenic
986204020 5:5606342-5606364 ATGTTGAATTAAATGCAAGATGG + Intergenic
986434955 5:7720295-7720317 ATTTTGACTTATAGAAAACAAGG - Intronic
988049883 5:26014154-26014176 ATGTTTATTTTGTTGAAACAAGG + Intergenic
988050140 5:26017147-26017169 ATGTTGGTATACATGAAACATGG - Intergenic
988462141 5:31449393-31449415 ATGATGACTTGGATGAGTCATGG + Exonic
991487341 5:67151142-67151164 AGATTCACGTAGATGAAACAAGG + Intronic
993090055 5:83414296-83414318 ACTTTGACTTAGATGATTCAGGG + Intergenic
993230826 5:85233464-85233486 ATGTTGACTTGAATGTAACTTGG + Intergenic
996840490 5:127842790-127842812 ATGATGTCTTAGATGCAACCTGG + Intergenic
998796306 5:145823318-145823340 ATCTTGACTTACATGAAATCTGG + Intronic
999029143 5:148270679-148270701 ATGTTGACTTGCATGGCACAGGG + Intronic
1000546740 5:162611783-162611805 ATGGTGACTGAGATAAAATAAGG + Intergenic
1000562757 5:162811211-162811233 ATTTTTGCTTAGATGAGACATGG + Intergenic
1000829987 5:166090968-166090990 ATGATGACTTTGATGATATATGG + Intergenic
1003670755 6:8155989-8156011 AGATGGACATAGATGAAACATGG + Intergenic
1007679233 6:43622929-43622951 ATTCTGACTTGGATGTAACAGGG + Intronic
1008029306 6:46675402-46675424 ATGATGACATAGATGAAATAAGG - Intronic
1012072546 6:94640991-94641013 ATGTTGTCTTACATGACAAAGGG - Intergenic
1012456855 6:99416756-99416778 TTATTAACTTAGATGATACAAGG + Intronic
1012574624 6:100778078-100778100 ATGATGACTTAAATGTAAGATGG + Intronic
1012664080 6:101943813-101943835 ATCTTGTCTCAGATGAAACTTGG + Intronic
1013936136 6:115596668-115596690 TTGTTGATTTAAATGTAACATGG - Intergenic
1014615486 6:123593043-123593065 ATGTTTAATTAGAAGTAACATGG - Intronic
1017318339 6:153058759-153058781 ATGCTGGCTTAGCTGAAGCAGGG - Intronic
1020218776 7:6217827-6217849 ATGTTAACTTACATGACAAAAGG + Intronic
1020596733 7:10215568-10215590 ATGTTGACTTACATGACAAAAGG - Intergenic
1021244356 7:18243690-18243712 TTGTTTACTTGAATGAAACATGG + Intronic
1027419298 7:78004299-78004321 TTGTTGACTCAGATTAAAAACGG + Intergenic
1027599251 7:80218891-80218913 CTGTTTACTTTGCTGAAACAAGG - Exonic
1030137496 7:106269746-106269768 ATGTGGACTTGGATCAAATAGGG + Intronic
1030310550 7:108064621-108064643 ATGTTCACTTAGCCCAAACATGG + Intronic
1031940311 7:127781942-127781964 ATGTTGTCTTAAGTGAAAAAGGG - Intronic
1033603794 7:142910112-142910134 TTAATTACTTAGATGAAACATGG + Intronic
1035991909 8:4500798-4500820 ATGTTGACTTACGGAAAACATGG + Intronic
1037342964 8:17866865-17866887 ATGCTGACTTAGAAGAACAAGGG + Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1040798726 8:51317562-51317584 ATGTTAACTTGGATGTCACATGG - Intergenic
1041984146 8:63900308-63900330 TTGTTGAGGTAGATGACACAAGG + Intergenic
1043637406 8:82403539-82403561 ATGTTGTGTCAGATTAAACAGGG + Intergenic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1043825624 8:84925285-84925307 TTATGGAATTAGATGAAACAGGG + Intergenic
1044103225 8:88167694-88167716 ATTTTGACTCAGATGAGCCATGG - Exonic
1045018428 8:98019797-98019819 ATTTTGACTTAATTGAAAAAGGG - Intronic
1046711524 8:117516769-117516791 ATGTTGCATTACATGAAACAGGG + Intergenic
1048131610 8:131703889-131703911 ATTTTGACTTTGGTGAAAGAGGG - Intergenic
1050543810 9:6692682-6692704 ATTTTGTCTTAGCTGAAATATGG - Intergenic
1050642026 9:7678508-7678530 AGGCTGACAAAGATGAAACAAGG - Intergenic
1050765830 9:9132481-9132503 ATATTAAACTAGATGAAACATGG + Intronic
1050784124 9:9377718-9377740 ATGTTGGCACAGATGAAACAAGG + Intronic
1050858370 9:10391632-10391654 ATGTTGACTTGGATGAAGGTTGG - Intronic
1052972130 9:34383049-34383071 AGGTTGCCTTAGATGGGACATGG - Intronic
1053594785 9:39548781-39548803 ATGTGAACTTACATGAAAAATGG + Intergenic
1053852569 9:42303814-42303836 ATGTGAACTTACATGAAAAATGG + Intergenic
1054571469 9:66816186-66816208 ATGTGAACTTACATGAAAAATGG - Intergenic
1054937121 9:70699884-70699906 ATGTTGACTTACAAGAATAAAGG + Intronic
1054941269 9:70744851-70744873 ATATTGAATCAGATGAAAAAAGG + Intronic
1055583738 9:77734081-77734103 ATGTTGACTTCGATGACAGCAGG - Intronic
1055863899 9:80789093-80789115 ATGTTGACTTAGAAAAAAGACGG + Intergenic
1056689136 9:88791366-88791388 AAGTTGACTTAGTTGCAAAAGGG - Intergenic
1057731900 9:97616685-97616707 ATGTTGGGAAAGATGAAACAAGG + Intronic
1057947493 9:99342292-99342314 ATAATGGCTTTGATGAAACAGGG + Intergenic
1060744995 9:126125622-126125644 ATGTTTACTTAGAGGAAAATGGG + Intergenic
1186356084 X:8792036-8792058 ATGTTGACTTAGTTGGCAAAAGG + Intronic
1187755906 X:22525768-22525790 ATAATGATTTAGATAAAACAAGG - Intergenic
1188636418 X:32437228-32437250 ATGTTGATTTGGATAAAATATGG + Intronic
1188877633 X:35450413-35450435 TTGTTGACTGAAATGAAAAATGG - Intergenic
1189097693 X:38157638-38157660 ATGTTACCTTACATGAAAAAAGG - Intronic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1190444187 X:50506604-50506626 ATGATGAGTTAAATGAAACAAGG - Intergenic
1191199811 X:57768210-57768232 ACATTCACTTAGATAAAACACGG - Intergenic
1194408359 X:93526497-93526519 ATGTTGCCTTACATGGAAAAAGG + Intergenic
1199768339 X:150956979-150957001 ATGTTGCCTTATATGGAAAAAGG - Intergenic