ID: 911139363

View in Genome Browser
Species Human (GRCh38)
Location 1:94482089-94482111
Sequence CCATAGGCTTAGGTGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911139357_911139363 -6 Left 911139357 1:94482072-94482094 CCTCACCTCATCTTCTTCCATAG 0: 1
1: 0
2: 0
3: 36
4: 306
Right 911139363 1:94482089-94482111 CCATAGGCTTAGGTGTGGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911139363 Original CRISPR CCATAGGCTTAGGTGTGGAG AGG Intronic
900698924 1:4031998-4032020 CCATAGCCTTGGGTGGGGTGGGG + Intergenic
901335482 1:8445468-8445490 CCAGATGCTTGGGTGTGGTGTGG - Intronic
903603145 1:24556431-24556453 CCAGATGCTTGGGTGGGGAGGGG - Intronic
904453818 1:30634739-30634761 CCATATGCTTATGTGTGCATTGG + Intergenic
904481077 1:30793658-30793680 CCACAGGCGTAGGTGGGGGGCGG + Intergenic
904605025 1:31693307-31693329 CCATATGCTTGTGTGTGGTGGGG - Intronic
910112093 1:83693560-83693582 CGATAGGCTTAGCTGTGCTGCGG - Intergenic
911139363 1:94482089-94482111 CCATAGGCTTAGGTGTGGAGAGG + Intronic
912563154 1:110564644-110564666 CCATATGCTGACCTGTGGAGAGG - Intergenic
912702527 1:111888857-111888879 CCCTGGGCTTTGGTGAGGAGAGG + Intronic
912978644 1:114351329-114351351 CCAGTGGCTGAGGTGTGGGGTGG - Intergenic
916417217 1:164603085-164603107 CCAAAGGGGTAGGGGTGGAGTGG - Intronic
919021260 1:192108710-192108732 CCTGAGGCTTAGTAGTGGAGAGG + Intergenic
919756742 1:201070712-201070734 CCATAGGCTGGGGGATGGAGTGG + Intronic
920033073 1:203048853-203048875 CCAGAGGCTCAGGTCTGGAATGG + Intronic
921696177 1:218213980-218214002 CCATGGACCTAGGTGAGGAGAGG + Intergenic
1065073752 10:22055049-22055071 CCAGAGGCTGAGGAGGGGAGAGG - Intergenic
1068861786 10:61855163-61855185 CCACAGACGTAGGTGGGGAGGGG - Intergenic
1070895926 10:79982897-79982919 CTCTGGGCTTTGGTGTGGAGAGG - Intergenic
1074544211 10:114389849-114389871 CCATAGGGTGAGGGGTGGTGGGG + Intronic
1075394764 10:122119378-122119400 CCAGGGGCTTAGGTGGGCAGGGG - Intronic
1077813036 11:5658054-5658076 CCACAGACTTAGGTGAGGACAGG + Intergenic
1080350738 11:31383039-31383061 CCATAGGGTGAGGTCTGTAGGGG + Intronic
1081329945 11:41790420-41790442 CCATGGGCCTAGGTGAGGACAGG + Intergenic
1082921496 11:58499517-58499539 CCATAGACTTGTGGGTGGAGAGG + Intergenic
1085326958 11:75613596-75613618 CCAGAGGCTCTGTTGTGGAGGGG - Intronic
1091091386 11:132774511-132774533 CCAAGGGCTTGGGTGTGGACTGG - Intronic
1092031880 12:5293355-5293377 CTATATGCTTAGATGGGGAGAGG + Intergenic
1094249343 12:28341302-28341324 CCATGGGCCTAGGTGAGGACAGG - Intronic
1096485215 12:51975745-51975767 CCATAGGCAGCGGTGAGGAGTGG + Intronic
1098512385 12:71332008-71332030 CCAGAGGCTGAGCTGTGGGGAGG + Intronic
1100598464 12:96091843-96091865 GCATTGGCTTAGCAGTGGAGTGG - Intergenic
1102431883 12:112890241-112890263 TCAGAGGCTTAGGTGTGGAGAGG - Intronic
1103972884 12:124682995-124683017 CCATGGGCTTGTGTGTGGGGAGG - Intergenic
1104127849 12:125864422-125864444 CCATCAGGTTAGGTGAGGAGAGG + Intergenic
1104375236 12:128260187-128260209 CCAAAGACTTAGGGGTGGAGAGG + Intergenic
1104672387 12:130689626-130689648 CCCAAGGCTTAGCTGGGGAGGGG + Intronic
1106015213 13:25863025-25863047 CCACAGTATTGGGTGTGGAGAGG + Intronic
1106024664 13:25945584-25945606 CCATGAACTTTGGTGTGGAGGGG + Intronic
1106476794 13:30105782-30105804 CCATGGGCTTCAGTGGGGAGAGG + Intergenic
1112924043 13:104651183-104651205 CCATAGACTAAGATGTGGTGGGG - Intergenic
1117766864 14:59092677-59092699 TCATATTCTTGGGTGTGGAGGGG - Intergenic
1120872706 14:89352412-89352434 CCAAAAGCTAAGGAGTGGAGAGG + Intronic
1121303414 14:92889853-92889875 GGATGGGCTCAGGTGTGGAGAGG + Intergenic
1125322595 15:38504531-38504553 CAATAGGATAAGATGTGGAGTGG - Intronic
1127799486 15:62465521-62465543 CTATCGGGTTATGTGTGGAGGGG + Intronic
1130747654 15:86673246-86673268 CCAGATGCTTAGGTATGAAGGGG + Intronic
1131647744 15:94363489-94363511 ACATAGGCAAAGGTCTGGAGAGG + Intronic
1131705360 15:94989444-94989466 CCATACTGTTAGGTGTGCAGTGG - Intergenic
1132406662 15:101545607-101545629 CCACAGGCTTAACTGTGAAGTGG + Intergenic
1136665747 16:31811003-31811025 TCATGGGCTAAGTTGTGGAGAGG - Intergenic
1137251710 16:46746091-46746113 CCATAGATTTTGCTGTGGAGGGG - Intronic
1138659749 16:58510072-58510094 CCAGAGGCTGAAGTCTGGAGGGG - Intronic
1141203483 16:81914829-81914851 CCATGGGGTGAGGTGGGGAGCGG - Intronic
1141962372 16:87417726-87417748 CCACAGGCCTGTGTGTGGAGTGG - Exonic
1142640271 17:1281357-1281379 CCAGAGGACTAGGTGTGGAGGGG + Intronic
1142669703 17:1482551-1482573 CCAAAGGCCTAGGAGTGGACAGG + Exonic
1143864587 17:9914692-9914714 CCAGAGGGTTAAGTGTGGAGAGG + Exonic
1144302811 17:13938804-13938826 CCATAGACCTAGGTGAGGACAGG + Intergenic
1144549677 17:16228808-16228830 CCAGAGGCTTGGGAGAGGAGGGG - Intronic
1146929592 17:36768048-36768070 CCAGGGGCACAGGTGTGGAGAGG + Intergenic
1150148040 17:62786750-62786772 CCATAAGCTTAAGTGTGAAAAGG + Intronic
1152067053 17:78117712-78117734 CCCAAGGCTTAGGGGTGCAGAGG - Intronic
1153773704 18:8434988-8435010 CCATGGACCTAGGTGTGGACAGG + Intergenic
1154352661 18:13599153-13599175 CCATAGGCTTTGTTGGGAAGTGG + Intronic
1155364570 18:25036818-25036840 CCATGGGCTGTGGTGTGGGGAGG + Intergenic
1158588117 18:58758285-58758307 CCATAGGCAGAGGTGTGGCATGG - Intergenic
1160415682 18:78708949-78708971 GCATGGGCTTAGTTGTAGAGTGG - Intergenic
1160598544 18:79994796-79994818 CCAGAGGGTTAGGGGTAGAGTGG - Intronic
1161645024 19:5447947-5447969 CCCTCGGCTGAGATGTGGAGGGG - Intergenic
1164432542 19:28200738-28200760 CCAGAGGCTTCAGTGGGGAGGGG - Intergenic
1167736115 19:51295558-51295580 TCAGAGGCATAGATGTGGAGGGG + Intergenic
926961750 2:18365003-18365025 CCATAGACCTAGGTTTGGACAGG - Intergenic
930891577 2:56394802-56394824 CCATTCTCTTAGGTGTGTAGTGG + Intergenic
932470590 2:71952702-71952724 GCAGAGGCTGAGGTGTTGAGAGG - Intergenic
932714431 2:74091001-74091023 ACATAGGCTTTGGTGTAGAGAGG - Intronic
932742244 2:74300618-74300640 ACATAGGCCTAGGTGGTGAGTGG - Intronic
932819347 2:74886428-74886450 GCACAGCCTTGGGTGTGGAGGGG + Intronic
933885037 2:86711430-86711452 CCATAGGTTAAGGGGTAGAGTGG + Intronic
933925137 2:87085254-87085276 CCATAGGTTAAGGGGTAGAGTGG - Intergenic
939511951 2:143117885-143117907 CCAAAGGCTGGGGAGTGGAGGGG + Intronic
940049472 2:149447300-149447322 CTATATGCTCAGGTGAGGAGGGG - Intronic
940360437 2:152790851-152790873 CCATAGGCACAGGTGTGGGGCGG - Intergenic
945466773 2:210178764-210178786 CTATAGTAATAGGTGTGGAGAGG + Intergenic
946082120 2:217130182-217130204 GCATAGGATGAGGTCTGGAGGGG + Intergenic
948047388 2:234954254-234954276 CCAAAGGCCCAGGTGGGGAGAGG + Intronic
948931577 2:241135747-241135769 CCAGAGGCTCAGGGGTGGTGGGG - Intronic
1172407780 20:34702419-34702441 CCCAAGGCTGAGGGGTGGAGAGG - Intronic
1175826398 20:61938676-61938698 CCATAGGCTGAGGTGGGGGCCGG - Exonic
1178476146 21:32939052-32939074 CCAAAGGCTGTGCTGTGGAGTGG - Intergenic
1179027422 21:37691251-37691273 CCCTAGGCTCAGGTGTAGGGGGG + Intronic
1182535428 22:30998743-30998765 CCAGAGGCTGAGGTGCTGAGTGG + Intergenic
1184334500 22:43845272-43845294 CCGGAGGCTGATGTGTGGAGGGG - Intronic
1184934237 22:47707274-47707296 CCATGGGCCTAGGTGAGGACAGG - Intergenic
1185393199 22:50573554-50573576 CCCCAGGCTGAGGTGGGGAGGGG + Exonic
952887229 3:38019165-38019187 CCATTGGCTGAGGTGTGGGTGGG - Intronic
953406753 3:42663577-42663599 CCCAAGGCTTAGGTGGGGAATGG - Intronic
953746141 3:45575462-45575484 CCATCGTCTCAGGTGGGGAGGGG - Intronic
954216959 3:49130072-49130094 CCTTAGGCTTAGGAGAGGACTGG - Intronic
956500975 3:69884906-69884928 TCATAGGCTTAGTTGTGTAAAGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957837557 3:85617391-85617413 ACATAGGGTGAGGTCTGGAGGGG + Intronic
958076561 3:88688977-88688999 CTATATACTTAGGTGTGTAGTGG - Intergenic
960996809 3:123345594-123345616 CCATAGGCTCAGGTTTAAAGTGG - Intronic
964620607 3:158717063-158717085 CCACAGGCCTGTGTGTGGAGTGG + Intronic
964754726 3:160083033-160083055 CCATAGGGTTACGTCTGGTGAGG - Intergenic
965569503 3:170157326-170157348 ACATAGGATAAGATGTGGAGGGG + Intronic
968830998 4:2933026-2933048 CCATGGGGTTAGGTGGGGAGAGG - Intronic
968877630 4:3281789-3281811 GCATAGGCTTAGAAGTGGATTGG + Intergenic
969535256 4:7752740-7752762 CCATTGGCTAAGGTGTTGGGAGG - Intergenic
970535360 4:17024720-17024742 CTATAGGCTATGGTGAGGAGAGG - Intergenic
971731380 4:30386643-30386665 CCACATGTTTAGGTGTGTAGTGG + Intergenic
976311140 4:83614792-83614814 CCAGAGGCATAAGTGTGCAGTGG + Intergenic
976405027 4:84653498-84653520 CCAAAGGCTGAGGCTTGGAGTGG - Intergenic
986847267 5:11770080-11770102 CCATGGGCTAAGTTGTGAAGAGG + Intronic
987390044 5:17367134-17367156 GCATAGGGTGAGGTGTGGAATGG + Intergenic
988071515 5:26295138-26295160 CCATAGGCATATATGTTGAGAGG - Intergenic
988611686 5:32732767-32732789 GCATAGGGTTTGGTGTGAAGAGG - Intronic
992173525 5:74127297-74127319 GCACAGGCTTGAGTGTGGAGAGG - Intergenic
995863245 5:116662997-116663019 ACATAGGGTTTGGGGTGGAGGGG + Intergenic
997425976 5:133802918-133802940 GCATATACATAGGTGTGGAGAGG + Intergenic
999175557 5:149629410-149629432 CCAGAGCCCTAGGTGTGGAGAGG + Intronic
1000016624 5:157283524-157283546 GAAGAAGCTTAGGTGTGGAGAGG + Intronic
1001176283 5:169471768-169471790 CCATAGCCATAGGGGTGGATGGG + Intergenic
1002069086 5:176668204-176668226 CCATGGCCTTGGCTGTGGAGAGG + Intergenic
1003369418 6:5510091-5510113 CCAAAGGCTGGGGTTTGGAGGGG + Intronic
1004912312 6:20298833-20298855 CCAGAGGTTGGGGTGTGGAGAGG - Intergenic
1005740581 6:28786946-28786968 GCACTGGCTTAGGTGTGGAGAGG + Intergenic
1005850999 6:29821905-29821927 ACAGAGCCTTAGGTGTTGAGGGG - Intergenic
1006579568 6:35069019-35069041 CCATGGGCCATGGTGTGGAGGGG - Intronic
1007013937 6:38443863-38443885 CCCTGGGCAGAGGTGTGGAGTGG - Intronic
1007378909 6:41474104-41474126 ACATAGGCCTAGATATGGAGGGG - Intergenic
1007389476 6:41542409-41542431 GCATATACTTAGGAGTGGAGTGG + Intergenic
1010948390 6:82005651-82005673 AGATATGCTTGGGTGTGGAGTGG - Intergenic
1012224545 6:96689027-96689049 CCATAGGCTTGGGGCAGGAGAGG + Intergenic
1014886264 6:126785099-126785121 GCATATGCTGAGTTGTGGAGTGG + Intergenic
1016109914 6:140210252-140210274 ACAAAGGCTCAGGTGTGGAAAGG - Intergenic
1016737559 6:147495631-147495653 CATTAGGTTTAGGTGTGTAGTGG - Intergenic
1019157184 6:170047150-170047172 CCATAGGGCGAGGTCTGGAGCGG - Intergenic
1021928374 7:25554846-25554868 CCATAAACTAAGATGTGGAGAGG + Intergenic
1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG + Intergenic
1025874854 7:65471388-65471410 CCAGAGGCAGAGGTGTGGTGAGG + Intergenic
1027356438 7:77360627-77360649 CCAAAGGCTAAGGAGTTGAGAGG + Intronic
1029402965 7:100356927-100356949 CCATAGGCTCAGGTGTGTGGAGG + Intronic
1029457352 7:100677959-100677981 TCAGAGCCTTAGGTGGGGAGGGG - Intronic
1031133697 7:117862292-117862314 CCAGAGCCCTAGGTGTGGGGTGG + Intronic
1031642430 7:124181086-124181108 CCATAGACCTAGGTGAGGACAGG - Intergenic
1037162014 8:15784748-15784770 CCAGAGGCTGAGGAGAGGAGAGG + Intergenic
1038029049 8:23621093-23621115 CCATAGGCACAGCTGGGGAGAGG - Intergenic
1038630504 8:29238848-29238870 CCTTACACTTAGGGGTGGAGAGG + Intronic
1041466421 8:58162076-58162098 CCATAGGCTTCTGTGTGGACTGG - Intronic
1042742078 8:72061063-72061085 CCATAGGCTTACTTGTAGACTGG - Intronic
1044865564 8:96567791-96567813 CCATAGTCTGAGAGGTGGAGTGG + Intronic
1046785954 8:118266823-118266845 CCAGAGGCTAGGGGGTGGAGGGG + Intronic
1047542560 8:125784730-125784752 CCATGGACTTAGGTGAGGACAGG + Intergenic
1048765865 8:137843824-137843846 CCACAGGCTTTGGCATGGAGTGG - Intergenic
1050043564 9:1520777-1520799 CCACAGACCTAGGTGTGGATAGG + Intergenic
1051144500 9:14012047-14012069 CCAAATGCTTAGCTGTGCAGAGG - Intergenic
1053486240 9:38458721-38458743 CCATAGTCTCAGGTGTGGGAAGG - Intergenic
1055185114 9:73442055-73442077 ACATAGGGTAAGGTCTGGAGGGG + Intergenic
1059494698 9:114699926-114699948 GCATAGGATAAGGGGTGGAGTGG - Intergenic
1060332441 9:122685752-122685774 CCAGTGGCTGAGGTGTGGTGGGG - Intergenic
1061269288 9:129527937-129527959 CCATTGGCTTCTGTGTGTAGAGG - Intergenic
1189173229 X:38929687-38929709 CCATAGACTGAGGGGTGCAGGGG + Intergenic
1190280772 X:48928074-48928096 CCATTCTCTTAGGTGTGTAGTGG - Intronic
1191146663 X:57173000-57173022 CCATAGACTTAGATGAGGACAGG - Intergenic
1192213512 X:69142510-69142532 CTGTAGGCTTAGGGGTGGGGAGG + Intergenic
1193321225 X:80123720-80123742 CCAGAGGCTGAGAAGTGGAGTGG - Intergenic
1194071323 X:89329262-89329284 GCTTGGGCTAAGGTGTGGAGAGG - Intergenic
1196943588 X:120801779-120801801 CCACATGCTTAGGGCTGGAGAGG + Intergenic
1197344959 X:125319894-125319916 CGATAGGGTTCGGTGTGGCGAGG + Intergenic
1197370686 X:125622104-125622126 CCAGGGGGTTTGGTGTGGAGGGG - Intergenic
1197887810 X:131236545-131236567 CCTCTGGCTTGGGTGTGGAGTGG - Intergenic
1198689694 X:139267284-139267306 CCATAGGATCATGTGTGGCGGGG - Intergenic
1198711351 X:139507827-139507849 CCATGGGCCTAGGTGAGGACAGG + Intergenic
1199743655 X:150758262-150758284 CCAGAGGACTGGGTGTGGAGGGG - Intronic
1200066906 X:153508303-153508325 CCATGGGCTTCGGGGTGAAGCGG + Exonic
1200725551 Y:6664985-6665007 GCTTGGGCTAAGGTGTGGAGAGG - Intergenic