ID: 911140884

View in Genome Browser
Species Human (GRCh38)
Location 1:94501341-94501363
Sequence CTGCATATATAACTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911140877_911140884 25 Left 911140877 1:94501293-94501315 CCATAATAGAGGCGTTTGGGAAA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911140884 Original CRISPR CTGCATATATAACTGGAGCA TGG Intronic
901556404 1:10034706-10034728 CTGTAGCTAAAACTGGAGCATGG - Intronic
901630253 1:10644467-10644489 CTCCATAAATAACTGCAGAATGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904922549 1:34020342-34020364 CTGCAAATATAGCTGGATAAAGG + Intronic
907441897 1:54484037-54484059 CTGCATATGTGCCTGGAGCCAGG + Intergenic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
910353132 1:86322833-86322855 ATGCATTTATAAGTTGAGCAAGG - Intergenic
911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG + Intronic
915694099 1:157721757-157721779 CTGCAGATTTACCTGGAGCATGG + Intergenic
916871073 1:168915386-168915408 CTGTATATATAAGGGGAGCTTGG - Intergenic
917026132 1:170644510-170644532 CTGTATATAAAACTAGAGAAAGG - Intergenic
917428309 1:174938603-174938625 CTGACTATATAACTAGCGCAAGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
1065100692 10:22329107-22329129 CTACATTTATACCTGGAGAAGGG + Exonic
1066474524 10:35732141-35732163 CTGCATATCCAACTGGATCAAGG - Intergenic
1066976255 10:42370613-42370635 GTGCATTTATCACTGGGGCAGGG - Intergenic
1070418618 10:76213977-76213999 CTGCACATCTACCTGGATCAGGG + Intronic
1070699356 10:78588455-78588477 CAGCCAAGATAACTGGAGCAAGG + Intergenic
1072773779 10:98168151-98168173 CTGCATATGTAACTGGCGGTAGG - Intronic
1078538552 11:12194904-12194926 CTGCCTGTATAACTGCAGAAAGG - Intronic
1078827494 11:14943366-14943388 CTGGATATAAAACAGGAACATGG - Intronic
1082780213 11:57281583-57281605 CTGCTTGTATAACTGCAGAATGG - Intergenic
1085323060 11:75586621-75586643 CTGCAGATGAAACAGGAGCAGGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087371924 11:97294948-97294970 ATACATATATGACTGGAGAATGG - Intergenic
1089923396 11:122231602-122231624 CTGCCTATAGGTCTGGAGCAGGG - Intergenic
1091839735 12:3612291-3612313 CTAAATATAAAACTGAAGCAAGG + Intronic
1095496122 12:42785880-42785902 ATGCATCTAAAACTGGGGCAGGG + Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1104384656 12:128339747-128339769 CTGCACATAGACCTGGAGCCAGG + Intronic
1105365332 13:19758927-19758949 CTACTTTTATAACTGGGGCAGGG - Intronic
1106747961 13:32723997-32724019 CTTCAAATATAAGAGGAGCAAGG - Intronic
1107996963 13:45870619-45870641 CTGCATTTAAATCTGAAGCAGGG - Intergenic
1108498284 13:51045830-51045852 CTGCATAGATCCCTGGAGCCTGG + Intergenic
1114795827 14:25713852-25713874 CTGTATATATAACTGTGGAAAGG - Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1116342532 14:43742930-43742952 TTGCATTTATAAATAGAGCATGG - Intergenic
1117154497 14:52924699-52924721 CTGGATATTTTACTGCAGCAAGG + Intronic
1117592616 14:57288848-57288870 ATCCATATGTTACTGGAGCAGGG - Exonic
1118561530 14:67088999-67089021 TTGCATATACATCTTGAGCAAGG - Exonic
1119498497 14:75102093-75102115 CTGCATATCTAACAAGGGCAGGG + Intronic
1124114108 15:26824065-26824087 GGGCATATTTAACTGGACCAGGG - Intronic
1124356980 15:29002972-29002994 GTGTATATATAACTGAAGCGTGG + Intronic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1128390430 15:67179222-67179244 CTAGATATTTAACTGGATCATGG - Intronic
1129166315 15:73780185-73780207 CAGCATTTCTAACTGGAGGAGGG + Intergenic
1133728062 16:8555610-8555632 CAGCAGATATAACTGGACCCCGG - Intergenic
1133890480 16:9874732-9874754 CTTCATATGTAACTGGAGGGAGG + Intronic
1138962929 16:62049179-62049201 CTGTATATATGACTGTAGCTTGG + Intergenic
1140136856 16:72213949-72213971 TTGAATATATAACTGAAACAAGG + Intergenic
1153904181 18:9646450-9646472 TTGCATAAATAACTGAAGTAAGG + Intergenic
1154929220 18:20974854-20974876 GAGCATATTTAAATGGAGCATGG - Intronic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1158451074 18:57565876-57565898 CTGTATATTTAACTGGAGCTGGG - Intronic
1166956342 19:46468008-46468030 CTGGCTAGATAACTGGAGGATGG + Exonic
926030747 2:9585570-9585592 ATACATATACCACTGGAGCATGG + Intronic
926332189 2:11834850-11834872 CTGCAAATAAAAAAGGAGCAGGG + Intergenic
927054098 2:19354214-19354236 CTGCAAAGATAACAGGAGCTGGG + Intronic
929133869 2:38603706-38603728 AAACATATTTAACTGGAGCAGGG - Intergenic
933146462 2:78860021-78860043 AGCCATATATAACTGGAGAATGG - Intergenic
935556141 2:104511587-104511609 CTGCATTTATAACAGCATCAGGG - Intergenic
935616899 2:105095412-105095434 CTGGATATATAACTGAGTCATGG + Intronic
937658646 2:124405442-124405464 CTGCATATATAAGTGGAGTCCGG - Intronic
938183135 2:129202686-129202708 CTGATTTGATAACTGGAGCAGGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
940442235 2:153730328-153730350 ATACAAATATAACTGGAGAAAGG + Intergenic
944291889 2:198017389-198017411 CTGCAGATTTAACTGGACAAAGG - Intronic
1169617257 20:7462473-7462495 CTGCACATATAACAAAAGCAAGG - Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1173182668 20:40816442-40816464 CTGCATATCTGAATGGGGCATGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1178591093 21:33910790-33910812 CTGCAGAGATAAATGGATCAAGG + Intronic
1183022098 22:35035442-35035464 CTGCAGACATTCCTGGAGCAGGG - Intergenic
949356425 3:3184886-3184908 CTGAAAATATTACTGTAGCAGGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
955935323 3:64097512-64097534 CTTCATTTTTAACTGAAGCAAGG + Exonic
956283970 3:67589360-67589382 CTGGAGATATAACTGGAGTAAGG - Intronic
959325923 3:104936663-104936685 TTGCATTTCTCACTGGAGCAGGG - Intergenic
960217299 3:115057476-115057498 TTACATAAATAATTGGAGCAGGG - Intronic
960231739 3:115236012-115236034 CAACATATATAATTGCAGCAAGG - Intergenic
961919004 3:130406465-130406487 CTGCATATCTGATTGAAGCAAGG + Intronic
965939315 3:174158550-174158572 CTGCATTTATAACAGCACCAAGG - Intronic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
981112366 4:140950387-140950409 ATGCATATATAGCTTTAGCATGG - Intronic
983721034 4:170851723-170851745 ATGCATATATAAGTGGAGGGAGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
994874159 5:105393241-105393263 CTGCATATGTAATTGGAGGAAGG - Intergenic
997147008 5:131445926-131445948 ATGCATATATATTTGGATCAAGG - Intronic
998692430 5:144601590-144601612 CTGCATATATGACTACAGGATGG - Intergenic
999409406 5:151337345-151337367 TTGCAGAGATCACTGGAGCAGGG - Intronic
999700261 5:154221332-154221354 CTTCCTATATGACTGGAGCAGGG + Intronic
1004969852 6:20897592-20897614 CTGAATATATAACTGAAGATTGG - Intronic
1013834290 6:114314418-114314440 CTCCATATTGAACTGCAGCAAGG - Intronic
1013924564 6:115454517-115454539 CTATAAATGTAACTGGAGCAAGG + Intergenic
1014683798 6:124469401-124469423 ATGCATATATTAATGGACCATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014930001 6:127324622-127324644 CCGATTATATAATTGGAGCAGGG + Intronic
1015595215 6:134859920-134859942 CTGCATCTAACACTGGAGAAGGG + Intergenic
1018143495 6:160862656-160862678 CTGCATATACACCTAGAACAAGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1023052780 7:36267637-36267659 CTGCATGTAAAACTGCAGCTGGG - Intronic
1024908330 7:54414820-54414842 ATATATATATATCTGGAGCAAGG + Intergenic
1026861232 7:73791228-73791250 CTCCATCTTTAACAGGAGCAGGG + Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030755913 7:113287700-113287722 CTGCATATATAACTCAAGGTTGG - Intergenic
1037773701 8:21818733-21818755 ATGCATGGATAACTGTAGCAGGG + Intergenic
1039247823 8:35629029-35629051 CTGCATATAAAACTGTTCCATGG - Intronic
1039573117 8:38602689-38602711 CTTTATAGAGAACTGGAGCAGGG + Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1043044486 8:75304190-75304212 CTCCATATATATCTGCTGCATGG - Intergenic
1044106404 8:88212455-88212477 TTAGATATATAACTGAAGCATGG - Intronic
1046632839 8:116638801-116638823 CTGTGTTTATAACTGGACCAAGG - Intergenic
1048608047 8:135990575-135990597 AAGCATATATAATTGAAGCAAGG - Intergenic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1052695704 9:31874684-31874706 CTGCGTTTATATCTGGATCATGG - Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1055149468 9:72978476-72978498 CTGCAAATATAACTGGATACAGG + Intronic
1055436316 9:76295586-76295608 CTGCTTTTATTACTGAAGCATGG + Intronic
1057893124 9:98884554-98884576 CTGGATATGAAACTGGAGCAAGG - Intergenic
1188047081 X:25438195-25438217 CTGGATATATCACTGGAACATGG + Intergenic
1190436930 X:50434591-50434613 CTGCAGATATCACTGGTCCATGG - Intronic
1192262683 X:69516430-69516452 CTCTCTATCTAACTGGAGCAGGG + Intronic
1194142341 X:90221585-90221607 ATAAATATATAACTGGAGGATGG - Intergenic
1196033302 X:111114936-111114958 CTGCAGATAAAACAGAAGCAGGG - Intronic
1197228166 X:123974527-123974549 CTGCATATATAAGATGATCATGG - Intronic
1199146993 X:144380231-144380253 TTCCATAAATATCTGGAGCAGGG - Intergenic
1200488094 Y:3790686-3790708 ATAAATATATAACTGGAGGATGG - Intergenic
1202037510 Y:20649361-20649383 TTCCACATATGACTGGAGCAGGG - Intergenic