ID: 911141405

View in Genome Browser
Species Human (GRCh38)
Location 1:94506708-94506730
Sequence CTGTCCAAAGAGAAGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911141401_911141405 7 Left 911141401 1:94506678-94506700 CCTCCTACCTAGTGTAAACTATG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 226
911141403_911141405 0 Left 911141403 1:94506685-94506707 CCTAGTGTAAACTATGTCCAAAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 226
911141402_911141405 4 Left 911141402 1:94506681-94506703 CCTACCTAGTGTAAACTATGTCC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 226
911141400_911141405 13 Left 911141400 1:94506672-94506694 CCATGGCCTCCTACCTAGTGTAA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911141405 Original CRISPR CTGTCCAAAGAGAAGATTCC AGG Intronic
900941336 1:5800467-5800489 CTTTCCAAAGATAGGATTCCTGG - Intergenic
903496874 1:23774765-23774787 CTCTCCAAAGAAAAAGTTCCTGG - Intergenic
904983759 1:34527723-34527745 CTGGGGAAAGAGAAAATTCCTGG - Intergenic
907912260 1:58836897-58836919 CAGTCCAAAGAGAAGGTTGGTGG - Intergenic
908166819 1:61467166-61467188 CTCTCCAAGGAGAAGAACCCTGG - Intergenic
908166912 1:61467989-61468011 CTCTCCAAGGAGAAGAACCCTGG + Intergenic
909281219 1:73756116-73756138 CTGACGAATGTGAAGATTCCTGG - Intergenic
911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG + Intronic
912484909 1:110018746-110018768 CTCTCCAAAGATAAAATTCAGGG - Intronic
915174126 1:154000617-154000639 CTGGACAAAGAGATGATTCATGG + Intronic
916572489 1:166039849-166039871 CTGTTCAAGGTGCAGATTCCTGG - Intergenic
916739234 1:167633687-167633709 CTGTCCATGGAGCAGAATCCAGG - Intronic
916849134 1:168684621-168684643 CTATTCAAAGAGAATCTTCCGGG - Intergenic
919269740 1:195325006-195325028 ATGTTCAAAAAGAAGTTTCCAGG - Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG + Intergenic
920715723 1:208338299-208338321 CTGTGCAATGATAAGTTTCCTGG - Intergenic
920772549 1:208903135-208903157 CTGACCTTAGAGAAGATTTCAGG + Intergenic
921071003 1:211657226-211657248 CTGTGCAAAAGGAAGATGCCAGG + Intergenic
922494913 1:226049008-226049030 CTATCAACAGAGAAGTTTCCTGG + Intergenic
922589798 1:226766245-226766267 CTGACCATAGTGAAGACTCCAGG + Intergenic
922967284 1:229701007-229701029 ATGTCCAAAGATATGATTCCTGG - Intergenic
923549551 1:234952258-234952280 CTTTCCACAAAGAAGACTCCAGG + Intergenic
1063139847 10:3246217-3246239 CTGTCCACAGACCAGCTTCCAGG - Intergenic
1063954024 10:11249323-11249345 CAGGCCACAGAGAAGATTCCAGG - Intronic
1064068982 10:12208959-12208981 CTGTGCAAAGAAAAGATTCTTGG + Intronic
1064071187 10:12229370-12229392 CTGGACAAAGAGAAGTATCCAGG - Intronic
1065702422 10:28438416-28438438 CTGACCAAAGCGAAGGTTTCAGG - Intergenic
1066471765 10:35705223-35705245 CTGTGCAATGAGAAGACCCCAGG - Intergenic
1068894442 10:62184073-62184095 CTGTCCAAATAGCAGACACCTGG + Intronic
1072200129 10:93150641-93150663 CTGTCCATAGACAAGAACCCAGG - Intergenic
1073174215 10:101542044-101542066 CTTTCCACAAAGAAAATTCCAGG - Intronic
1073494836 10:103881419-103881441 CTGTACACAGAGAAGATGCAGGG + Intergenic
1073648417 10:105332191-105332213 CTGGACAAAGATAAGATTTCTGG + Intergenic
1074166479 10:110881468-110881490 CAGTCCAAAGGGAAGGTTGCTGG + Exonic
1076337434 10:129717739-129717761 CTGTCCTCAGAGAAGAGTCAGGG - Intronic
1076610362 10:131722437-131722459 CTGTCCACTGAGAGGAGTCCAGG + Intergenic
1077139106 11:1015780-1015802 GTGTCCCGAGAGAAGATACCGGG + Exonic
1079326245 11:19494965-19494987 CTGTCCTCAGAGGAGAATCCTGG + Intronic
1080105300 11:28505427-28505449 CTGACCAGAAAGAACATTCCAGG - Intergenic
1081716466 11:45254072-45254094 CAGTCCAAAGTGGGGATTCCTGG - Intronic
1083237951 11:61364051-61364073 CTCTGCATTGAGAAGATTCCAGG + Intronic
1083567551 11:63732704-63732726 CTTTCCACAAAGAAAATTCCAGG + Intronic
1084332427 11:68437979-68438001 CTGCCCATAGGGAAGTTTCCAGG - Intronic
1085099020 11:73784568-73784590 CTGCACAAGGAGAAAATTCCTGG + Intergenic
1085957312 11:81415111-81415133 CTGGCTTAAGAGAAGATACCTGG + Intergenic
1087135548 11:94714506-94714528 CTCTCCAAAAAGAAATTTCCAGG - Intronic
1088247258 11:107830883-107830905 CTTTCAAAACATAAGATTCCTGG + Intronic
1088898033 11:114092551-114092573 CTCTCCAAAGAGAAGTTTCAGGG + Intronic
1091654846 12:2338027-2338049 CTGTGCAGAGAGGGGATTCCAGG - Intronic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1098512340 12:71331465-71331487 GTGCCCAAAGAGAAGATTTCTGG - Intronic
1100424015 12:94465411-94465433 CTAGACAAAGAGATGATTCCAGG + Intergenic
1101239173 12:102821013-102821035 CCTTCCAAAAAGAAGATTCTAGG - Intergenic
1103926638 12:124427074-124427096 ATTTCCAAAGGGAAGATTCATGG - Intronic
1104798335 12:131535551-131535573 CTGTCAAAAAAGAAGAATTCTGG + Intergenic
1108229709 13:48323147-48323169 CTTTCCACAGAGAAAAGTCCAGG - Intronic
1108394100 13:49976455-49976477 CTGTGCAAAGAGAAAATGCTAGG + Intergenic
1109011681 13:56957063-56957085 CTTTACAAAGAGAAAATTCCAGG - Intergenic
1110929666 13:81199221-81199243 CAGTCAGAAGAGAAGATTCAGGG + Intergenic
1113914594 13:113863107-113863129 AGGTCCAAAAATAAGATTCCAGG - Intronic
1114904356 14:27107507-27107529 CTTTCCACACAGAAAATTCCAGG + Intergenic
1116070269 14:40035076-40035098 CTGTCCAAATAGCAGATGACAGG + Intergenic
1116762599 14:49033031-49033053 ATGGCCAAAGAAAAGCTTCCTGG - Intergenic
1117495967 14:56304475-56304497 CTGTCCAAAGTGAAAATTCATGG - Intergenic
1118506310 14:66415873-66415895 CTGTAAAAAGAGAAAATTACAGG + Intergenic
1118735274 14:68696623-68696645 CTGTCTTAAGGGAAGTTTCCTGG - Intronic
1119330803 14:73792159-73792181 CTCTGCTAAGAGAAGACTCCAGG - Intergenic
1119887709 14:78157326-78157348 ATCCCCAATGAGAAGATTCCAGG + Intergenic
1121480213 14:94262171-94262193 CTTTCCAAAATGAAAATTCCAGG - Intronic
1121618778 14:95331952-95331974 CTGTCCAGAGATCAGAATCCTGG + Intergenic
1126383891 15:48074473-48074495 ATGTCCAAAGAGAAGGTTGGGGG - Intergenic
1127267369 15:57373139-57373161 CTTGCCAAAGAGAAGTTTCCAGG - Intergenic
1127544999 15:59984949-59984971 CTTTCCACAAAGAACATTCCAGG + Intergenic
1127586365 15:60381981-60382003 CTCTCCAAAGAGAAGAAACGGGG + Intronic
1127690140 15:61387293-61387315 TTGGCCAAGGAGAAGAATCCAGG + Intergenic
1128035601 15:64522670-64522692 CTTTCCAAAGAGAAGAAAGCAGG - Intronic
1128165822 15:65463861-65463883 CTTTCAAAAGAGAAAATTTCTGG + Exonic
1128173329 15:65531486-65531508 CTGTCCAAACTAAAGATTCTGGG + Intronic
1129051766 15:72786864-72786886 ATTTCCAAAGTGAAAATTCCGGG - Intergenic
1130890960 15:88133459-88133481 GTTTCCAAAGAGAAGCTTCTGGG - Intronic
1131343928 15:91628598-91628620 CTCTCCAAGGAGAGGATTCAAGG + Intergenic
1134825127 16:17278354-17278376 CTGTCCAAAGGGAAGCAGCCCGG - Intronic
1135564501 16:23501105-23501127 CTTTCACAAGAGAAGGTTCCAGG + Intronic
1137865655 16:51893449-51893471 CTGTGCAAAGAGCAGATTACAGG + Intergenic
1140536214 16:75712202-75712224 CTGCCCTAAGAGAAGAATCATGG + Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1140865304 16:79055590-79055612 CTGTCCAAACTGAAGATTCATGG + Intronic
1141683694 16:85558136-85558158 CTCTCCCATGGGAAGATTCCAGG + Intergenic
1143248515 17:5505104-5505126 CTGTGGAAAGGGGAGATTCCTGG - Intronic
1145106360 17:20121209-20121231 CTTTCCAAAGCCAAGGTTCCTGG - Intronic
1146590983 17:34127814-34127836 CTGTACAAAGAGCAAATTCAGGG + Intronic
1149327888 17:55550963-55550985 CTCTGCAAAGAGAGGATACCTGG + Intergenic
1149545116 17:57497667-57497689 TTATCCAAAATGAAGATTCCTGG + Intronic
1149725447 17:58888656-58888678 TTGTTTAAAGAGAAGAGTCCTGG - Intronic
1154381242 18:13851950-13851972 TTCTCCTAAGAGAAGAGTCCAGG - Intergenic
1155025797 18:21939655-21939677 CAGTTCAAAGAGTAGATTCCAGG - Intergenic
1158095048 18:53761040-53761062 ATGTCCAGAGAGAAGATGTCAGG - Intergenic
1160117050 18:76089369-76089391 CTGTCCTCATAGAACATTCCTGG + Intergenic
1162037310 19:7948292-7948314 CTGTGCACAGTGAATATTCCTGG - Intergenic
1163668077 19:18612392-18612414 GTGTCAAAAGAGAAGATGCCAGG + Intronic
1165251840 19:34544913-34544935 CTGTCAAAAGGTATGATTCCAGG - Intergenic
1165274842 19:34739600-34739622 CTGTCAAAAGGTATGATTCCAGG + Exonic
1166498025 19:43319065-43319087 ATGCCCAAAGAGAGGATTCTTGG + Intergenic
926268866 2:11349869-11349891 CTGTAGAAAGACCAGATTCCAGG - Intergenic
926289515 2:11517314-11517336 CAGTCCAAAGAGCAGGTGCCTGG - Intergenic
927058971 2:19395997-19396019 CTGTACAAAAAGAAGATTGGTGG + Intergenic
928745377 2:34407682-34407704 CTGTCCTGAGCTAAGATTCCAGG + Intergenic
929873651 2:45778337-45778359 ATGTCCCAAGAGAACATGCCTGG + Intronic
933483394 2:82885739-82885761 CTTTACATAGAGAAGTTTCCAGG + Intergenic
935088716 2:99873785-99873807 ATGTCCACTGAGAACATTCCTGG + Intronic
936839558 2:116753663-116753685 CTGTGCCAAGAGAAGACACCAGG + Intergenic
938024199 2:127931395-127931417 CTGTCCAAACACAAAATTCCAGG - Intergenic
939741858 2:145917547-145917569 CTGGCCAAAATGAAGATCCCAGG + Intergenic
940494350 2:154406340-154406362 CTGTGCAAAGAGCAGATTAGAGG - Intronic
941641274 2:167991381-167991403 CTGCCCAAAGAGAAGAGTAAAGG + Intronic
942654534 2:178201204-178201226 CTGTCCAAAGAAAATATTGGTGG + Intronic
943229784 2:185234446-185234468 CTGCCCACAAAGAAGATTCCAGG + Intergenic
943381069 2:187148991-187149013 TTTTTCAAAGAGAATATTCCTGG - Intergenic
945326175 2:208485386-208485408 CTGTCCAATAAGATGATTCAGGG - Intronic
946940618 2:224766577-224766599 GTGTTCAAAGAGTAGACTCCAGG + Intronic
947102201 2:226633033-226633055 CTGCTCAAAGAAAAGATCCCCGG + Intergenic
947600558 2:231446265-231446287 CTTTCCACAGAGAAAACTCCAGG - Intergenic
948707332 2:239803203-239803225 CTGATCAAATAGAAGATCCCTGG + Intergenic
1169605670 20:7316071-7316093 CTCTCCAAAGAAAGGAATCCTGG - Intergenic
1169782404 20:9323696-9323718 CTGTCCAATGAGGGGACTCCTGG - Intronic
1172083772 20:32362205-32362227 CTGCCCAAAGAGAAGTGTTCAGG - Intronic
1172355504 20:34276985-34277007 CTGTCCCAACAGCAGCTTCCTGG + Intergenic
1174087029 20:48016653-48016675 CTGGCCAGATAGATGATTCCTGG - Intergenic
1175252503 20:57617934-57617956 CTGGCCAAGGAGAAGCTACCCGG - Intronic
1178633257 21:34280804-34280826 CTGTACAATGACCAGATTCCAGG - Intergenic
1181373745 22:22439947-22439969 CTGTCCAGTGAGAAAACTCCAGG + Intergenic
1181825375 22:25511098-25511120 CTGTTTAAAGTGCAGATTCCTGG - Intergenic
1181963916 22:26643230-26643252 TTGTGTCAAGAGAAGATTCCAGG - Intergenic
1182861276 22:33561503-33561525 CTGTCCTAACAGAACATTCAGGG - Intronic
1185144043 22:49119816-49119838 CTGTCCCATGAGCAGATTCCTGG + Intergenic
949227003 3:1706131-1706153 CTGTCCAGAGAGGAGACACCTGG - Intergenic
950186312 3:10947824-10947846 CTGTCCCAAGAGGAGCATCCAGG + Intergenic
952337309 3:32415077-32415099 CTGTTCAAAACGCAGATTCCTGG + Intronic
952997789 3:38902080-38902102 CTGTCCACAGAGATGACTCTGGG + Intronic
955113590 3:55974514-55974536 CTGTCCCAAAAAATGATTCCTGG + Intronic
956345980 3:68279285-68279307 CTGTATAAAGAATAGATTCCTGG - Intronic
956961659 3:74409631-74409653 CTGTCCAAAGAATAGTTTCTAGG - Intronic
958835192 3:99137419-99137441 GTGTACAAAGAGAAGATTCTAGG + Intergenic
961091464 3:124116148-124116170 ATGACCAAAGAGAAGATATCTGG - Intronic
963129009 3:141840836-141840858 CTGTCCCAAGAAAAGAGTCCTGG + Intergenic
963415216 3:144986128-144986150 ATGTTCAAAGAGAAAAATCCTGG - Intergenic
965004447 3:163000986-163001008 CTTTCCAAAGATAATTTTCCAGG - Intergenic
967100038 3:186208893-186208915 CTGATAAGAGAGAAGATTCCAGG - Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968576928 4:1371031-1371053 CTCTCCAAACAGAGCATTCCCGG + Intronic
971146431 4:23981555-23981577 CTGACCAAAGAGAAGGGGCCAGG + Intergenic
975240197 4:72048277-72048299 CTTACCCAAGAGAAGATTTCAGG + Intronic
977208595 4:94192350-94192372 ATGTCCTAAGATAAGAATCCAGG - Intergenic
978666012 4:111182918-111182940 ATGTCCAGAGAGAAGCTTGCTGG - Intergenic
980999350 4:139813537-139813559 CTGACCAAATAGAGGATTCTAGG - Intronic
982090210 4:151873833-151873855 CTTTCCAGGGAGCAGATTCCAGG + Intergenic
982649201 4:158065396-158065418 CTGGCCAAAGGGAAGATACCAGG + Intergenic
984682215 4:182623651-182623673 CTGCCTGAAGAGAAGATTCTAGG - Intronic
985337355 4:188911217-188911239 CAGTCAAAAGAGAAGATACTAGG - Intergenic
987769970 5:22289484-22289506 TTGTCCAAAGACAATATTCATGG - Intronic
988060478 5:26161397-26161419 CTCTCCAAAGAAAAAGTTCCTGG + Intergenic
988374213 5:30412971-30412993 CTGAAGAAAGAGAAGATTCCGGG - Intergenic
988959244 5:36353154-36353176 CTGTTCAAAGAAGAAATTCCAGG + Intergenic
989005524 5:36807206-36807228 CTGTCTACAGAGAAGATTCCAGG - Intergenic
990439043 5:55825367-55825389 CTGTCCAAAAAGGGTATTCCTGG + Intergenic
995558987 5:113360554-113360576 CTTTCCACAAAGAAAATTCCAGG - Intronic
997410163 5:133684905-133684927 CTTTCCAAAGAGAAGCTCCAGGG + Intergenic
999310705 5:150549996-150550018 CAGACCAAAGAGAAGACCCCAGG - Intronic
999552331 5:152702959-152702981 CTGTCAAAACAGAAAACTCCAGG - Intergenic
1000337099 5:160249908-160249930 CTGGCTAAAGTGCAGATTCCAGG + Intergenic
1003366508 6:5479994-5480016 CTTTCCAAAGAGTAGATTATTGG + Intronic
1003477661 6:6498837-6498859 ATGTCCAAAGAGGAAATTCAGGG - Intergenic
1005731874 6:28705516-28705538 CTTTACAAGCAGAAGATTCCAGG + Intergenic
1006428860 6:33982914-33982936 CTGTCCAAAGGGGAGCTGCCAGG + Intergenic
1007423092 6:41731373-41731395 CTGTCCCAAGAAAAACTTCCTGG + Intronic
1009445676 6:63739430-63739452 CTGTTTAAAGAGAAGATGACAGG - Intronic
1010427371 6:75742401-75742423 CTGTCCAAACTGCAGATTTCAGG + Intergenic
1012430097 6:99155046-99155068 CTGTCCAAAGGGAACCTTGCAGG - Intergenic
1013311451 6:108898357-108898379 GTGTCCACACAGAAGATGCCTGG - Intronic
1013419582 6:109954576-109954598 CTTTTCAAAAAGAAAATTCCAGG + Intergenic
1016152091 6:140753670-140753692 ATGTCAAAAGGGAAGATTACAGG + Intergenic
1017901976 6:158726233-158726255 CTGTCCAAAGACAAAATTTCAGG + Intronic
1018431027 6:163723051-163723073 CTTTCCAAAGGCAAGCTTCCCGG - Intergenic
1018558958 6:165080945-165080967 CTGTCCACAGTGAAAATTCCAGG + Intergenic
1020452663 7:8337619-8337641 CTGTCCAAAGAGACAACTCAAGG - Intergenic
1022355736 7:29612661-29612683 CTGACCAAAGAGAAGCTTCTGGG + Intergenic
1024227804 7:47340676-47340698 TTGTCCAAACAGAAAATCCCAGG - Intronic
1026229432 7:68470324-68470346 CTGGGCAAAGAGAGGATACCCGG + Intergenic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1028764502 7:94537032-94537054 CTTTCAAAACAGAAGATACCAGG - Intronic
1030013956 7:105199926-105199948 CTGTGAAAAGAGTAGACTCCAGG + Intronic
1030585458 7:111413226-111413248 CTTCCCAAAAAGAAAATTCCTGG + Intronic
1030745113 7:113155849-113155871 CTTCCCAAAGGGAAAATTCCAGG - Intergenic
1030790652 7:113723521-113723543 CTGTAAAAAGAGCATATTCCAGG - Intergenic
1033524885 7:142201416-142201438 ACGTCCATAGAGTAGATTCCTGG + Intronic
1033551716 7:142453387-142453409 ATGTCCATGGAGAAGAGTCCAGG - Intergenic
1034228775 7:149502511-149502533 CTGACCCCAGAGAAGATGCCAGG - Intergenic
1034811796 7:154138846-154138868 ATGACCAAAGTGAAGCTTCCTGG + Intronic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1036632287 8:10524228-10524250 CTGCCCAGGGAGGAGATTCCAGG - Intergenic
1037652014 8:20847524-20847546 CTGTCCAAATCCAAGAATCCTGG + Intergenic
1038579864 8:28738652-28738674 CTGTCCTCAGAGAAGACTCAGGG - Intronic
1039257110 8:35731701-35731723 CTCTCCAAAGAAAATATCCCCGG + Intronic
1040753659 8:50743013-50743035 CTGTCAACAGAGAAGAGGCCTGG + Intronic
1041068759 8:54106014-54106036 CAGTCCCAAGAGAAGATTCTTGG + Intergenic
1041955794 8:63556898-63556920 CAGTCCAATGTGAAGAATCCAGG - Intergenic
1041990250 8:63979829-63979851 CTGTCTCAAGAGAACATTCTGGG - Intergenic
1043889821 8:85643236-85643258 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043891359 8:85655144-85655166 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043892432 8:85661981-85662003 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043893125 8:85715354-85715376 CAGTCCAAGGCGTAGATTCCTGG - Intergenic
1043895812 8:85736808-85736830 CAGTCCAAGGCGTAGATTCCTGG - Intergenic
1043896867 8:85745000-85745022 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043899190 8:85763366-85763388 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043900801 8:85775561-85775583 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043902765 8:85790836-85790858 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043904375 8:85803029-85803051 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043905987 8:85815223-85815245 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1043907595 8:85827410-85827432 CAGTCCAAGGCGTAGATTCCTGG + Intergenic
1044420724 8:91993031-91993053 CTGTCTAAAGATAAGAGTGCTGG - Intronic
1046575049 8:116017655-116017677 ATGACAAAAGAGAAGATACCTGG - Intergenic
1047203589 8:122785807-122785829 CTGTGCAAAGAGATGATGCCAGG + Intronic
1047791009 8:128203608-128203630 CTGCCCAAAGAGATGATTAAAGG - Intergenic
1047846948 8:128816445-128816467 CAGTCCAAAGTGAGTATTCCTGG - Intergenic
1048134014 8:131728412-131728434 CTGTGCAACGTGAAGCTTCCAGG + Intergenic
1049142046 8:140963814-140963836 CATTCCAAATAGAATATTCCAGG + Intronic
1050930658 9:11320220-11320242 CTCTCTAAATAGAATATTCCAGG + Intergenic
1051137355 9:13937274-13937296 CTCTCCAAAGACAAAATTTCTGG - Intergenic
1052040010 9:23727616-23727638 CTGTCCACAGGTGAGATTCCGGG - Intronic
1052357135 9:27516746-27516768 CTGTCCAAAGAGAATATATGGGG - Intronic
1052603062 9:30663127-30663149 TTGACAAAAGAGAATATTCCTGG + Intergenic
1053728631 9:41029519-41029541 TTTTCCAAAGACAAGATTGCAGG + Intergenic
1054699875 9:68402561-68402583 TTTTCCAAAGACAAGATTGCAGG - Intronic
1055467807 9:76582812-76582834 CTTTTCAAAGAGAAAATGCCTGG + Intergenic
1056690805 9:88807271-88807293 CTGTCCAAAGAGCAGACCCCAGG - Intergenic
1061729822 9:132605017-132605039 CTGTCCTAAGAGAACAGGCCTGG - Intronic
1061834689 9:133321101-133321123 CTTGGAAAAGAGAAGATTCCAGG - Intergenic
1185889380 X:3810775-3810797 CTGTCCAAGGAGAAGGACCCTGG - Intergenic
1186337335 X:8604322-8604344 CTTTCCAAAGTGCAGTTTCCAGG - Intronic
1186442700 X:9599864-9599886 CTCCCCAAAAAGAAGTTTCCTGG - Intronic
1186854044 X:13609120-13609142 ATGTCCAAAGAGAATTTTTCAGG + Intronic
1187754366 X:22504665-22504687 CTTCCCAAAGAGAAAATTCCAGG - Intergenic
1190640477 X:52479031-52479053 CTGTTAAAAGTGCAGATTCCAGG - Intergenic
1190647195 X:52533834-52533856 CTGTTAAAAGTGCAGATTCCAGG + Intergenic
1190649402 X:52554854-52554876 CTGTTAAAAGTGCAGATTCCAGG + Intergenic
1192528924 X:71870107-71870129 CTGTCCTAAGAGAAGATCTCTGG + Intergenic
1192672292 X:73158582-73158604 CACTCCAAAGAGAACATTCTTGG - Intergenic
1194254674 X:91622022-91622044 CTGTCCAGAGAGAAGAAATCTGG + Intergenic
1194776916 X:97976513-97976535 ATGAACAAAGAGAAGATTGCTGG - Intergenic
1197964563 X:132044582-132044604 GTTTCCAAAGGGAAAATTCCAGG - Intergenic
1200272469 X:154698940-154698962 CTGTCTAATGAGGAGATGCCAGG + Intronic
1200359752 X:155592312-155592334 ATGTCAAAATAGGAGATTCCAGG + Intronic
1200573460 Y:4861625-4861647 CTGTCCAGAGAGAAGAAATCTGG + Intergenic
1201786049 Y:17780422-17780444 CTGACCAAAGACAAAAATCCAGG - Intergenic
1201815504 Y:18125566-18125588 CTGACCAAAGACAAAAATCCAGG + Intergenic
1202375386 Y:24230643-24230665 CTGTCCAAGGACATGATGCCGGG - Intergenic
1202495394 Y:25439476-25439498 CTGTCCAAGGACATGATGCCGGG + Intergenic