ID: 911143262

View in Genome Browser
Species Human (GRCh38)
Location 1:94528441-94528463
Sequence TTTGCTTCCCACTGTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911143262_911143267 -1 Left 911143262 1:94528441-94528463 CCCCTTCCACAGTGGGAAGCAAA 0: 1
1: 0
2: 2
3: 32
4: 267
Right 911143267 1:94528463-94528485 AAGCAGTCTTGTGGCCCAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 101
911143262_911143266 -10 Left 911143262 1:94528441-94528463 CCCCTTCCACAGTGGGAAGCAAA 0: 1
1: 0
2: 2
3: 32
4: 267
Right 911143266 1:94528454-94528476 GGGAAGCAAAAGCAGTCTTGTGG 0: 1
1: 0
2: 1
3: 29
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911143262 Original CRISPR TTTGCTTCCCACTGTGGAAG GGG (reversed) Intergenic
901377240 1:8848156-8848178 TTTGCTTCCCAGTGAGGCGGAGG + Intergenic
904481552 1:30797201-30797223 TTTGCTGTCCACTGTGGCGGGGG - Intergenic
904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG + Intronic
905952140 1:41960821-41960843 TTTTCTGCCCACAGTGGAGGGGG - Intronic
907977005 1:59441287-59441309 TTTGCTTCTAACTGTGCAGGAGG + Intronic
909979660 1:82083391-82083413 TTGGCTTACCACAGTAGAAGAGG + Intergenic
910832738 1:91476930-91476952 TTTGCTTCCCTCTGTGGGGTGGG + Intergenic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
911372135 1:97006342-97006364 TTCTCTTCCCACTGGGGAATGGG + Intergenic
912004009 1:104873000-104873022 ATAACTTCCCACTGTGTAAGTGG + Intergenic
912483453 1:110004128-110004150 ATTGCTTCTGACTGTGGAATTGG + Intronic
913126153 1:115792264-115792286 ACTGCTTTCCACTGTGGGAGTGG - Intergenic
915717554 1:157958677-157958699 TTTACTTCTTGCTGTGGAAGGGG - Intergenic
916329666 1:163600431-163600453 TTTGGATCCCACTGTGACAGGGG + Intergenic
920279296 1:204830726-204830748 TGTGGTTGCCACTGTGGAACAGG + Intronic
921095089 1:211879398-211879420 TTTGCTTTCCACTCTGGGATGGG + Intergenic
921278411 1:213542025-213542047 TTTGCCTCCCTCTGTGGATAGGG + Intergenic
922095447 1:222439470-222439492 TTTGCTTCCCACTGGGAATGGGG - Intergenic
922643872 1:227265151-227265173 TCTTCCTACCACTGTGGAAGTGG - Intronic
924788559 1:247221653-247221675 CATGGTTTCCACTGTGGAAGAGG + Intergenic
924805145 1:247355975-247355997 CATGATTTCCACTGTGGAAGAGG + Intergenic
1063122247 10:3113297-3113319 TTTGCTGCACACTTTGGCAGTGG - Intronic
1065019727 10:21494586-21494608 TTTGCTTCCCAATTTAAAAGTGG + Exonic
1066237505 10:33500778-33500800 TTTTCGTCCTACTGTGGAAGTGG + Intergenic
1066817018 10:39431670-39431692 TTTGCTGCCTACGGTGGAAAAGG - Intergenic
1067196604 10:44125270-44125292 TGTGCATCTCACTGTTGAAGTGG - Intergenic
1068965074 10:62903653-62903675 TTTGCTATCCACTGGGGATGTGG - Intronic
1069925894 10:71850866-71850888 TGCGCTTCCCACTGTGGGGGTGG - Intronic
1070918972 10:80172167-80172189 TTTGGTCCCCACTGTGGGAAAGG - Intronic
1071199701 10:83205946-83205968 TTTGCTTGCTGCTCTGGAAGAGG + Intergenic
1071269309 10:83992149-83992171 CCTGCTTCCCACAGGGGAAGTGG - Intergenic
1072529437 10:96304778-96304800 TTTTCTTCCACATGTGGAAGAGG + Intronic
1072682678 10:97517989-97518011 TTTACTTCCTAGTGTGGAACTGG + Intronic
1073202637 10:101748725-101748747 TGTGCATCCCACCCTGGAAGAGG - Intergenic
1074158020 10:110815096-110815118 TTCCCTGCCCCCTGTGGAAGGGG - Intronic
1075382944 10:122033655-122033677 TTTGCCATCCACTGGGGAAGAGG + Intronic
1075520217 10:123138988-123139010 TCTGTTTCCCACGGTGGAGGAGG - Intergenic
1075622292 10:123936835-123936857 ATTGCTACCCACAGAGGAAGAGG - Intronic
1076295072 10:129377864-129377886 TTTGTTTCCCACAGAAGAAGCGG + Intergenic
1076653643 10:132006910-132006932 TTTGCTTTGCACTGTGGACTTGG + Intergenic
1079004790 11:16783909-16783931 CTTGCTTCCCATGGTGGGAGGGG - Intronic
1079782951 11:24632026-24632048 TTTGCTTTTTACTATGGAAGTGG + Intronic
1080091801 11:28357108-28357130 TTTGCTTTTTACTTTGGAAGGGG + Intergenic
1081349590 11:42034139-42034161 TTTGCTTTGCACTTTGGCAGGGG - Intergenic
1082041808 11:47692210-47692232 TTTGCCTCCCACTCTGGAACTGG + Exonic
1082155792 11:48809945-48809967 TTTGAGTCCTACTGTGGAAAAGG + Intergenic
1082156814 11:48831117-48831139 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1082157133 11:48836692-48836714 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1083427035 11:62593541-62593563 TTTGCCTCCCTTTGTGAAAGGGG - Exonic
1083706246 11:64518365-64518387 GTTATTTCCCACTGGGGAAGGGG - Intergenic
1084095612 11:66909169-66909191 TCTGCCTCCAGCTGTGGAAGAGG - Intronic
1090440693 11:126722993-126723015 TTTGTCTCCCACGGTGGAATTGG + Intronic
1090540801 11:127700968-127700990 GTTGCTTCCCACAGAGGTAGGGG - Intergenic
1092128751 12:6093698-6093720 TTCCCTCCCCACTGTGGAACAGG - Intronic
1093090816 12:14918266-14918288 TTTGCTATCCACTGTGCATGAGG - Intronic
1094030570 12:26007246-26007268 TTTGATCCCCAGTGTGGCAGTGG - Intronic
1095058166 12:37643748-37643770 TTTGATGCCTACTGTGGAAAAGG - Intergenic
1095061704 12:37701702-37701724 TTTGCGTCCTACGGTGGAAATGG - Intergenic
1097937424 12:65269414-65269436 TCTGCTTCCCAGTGGGGATGAGG - Intergenic
1099003084 12:77204232-77204254 ACAGCTCCCCACTGTGGAAGGGG - Intergenic
1099331502 12:81294792-81294814 TTTGCCTAGCACTGAGGAAGGGG + Intronic
1101994982 12:109518825-109518847 TTTACTTTCCACTGGAGAAGGGG + Intronic
1102780149 12:115557241-115557263 TTTGCCTCCTTCTGTGGAAAAGG - Intergenic
1104298326 12:127539527-127539549 TGTGCATCCCACAATGGAAGAGG - Intergenic
1105567475 13:21564755-21564777 TTTCCCTCCCAATGAGGAAGAGG + Intronic
1106933189 13:34689606-34689628 TGTCCTGCCCACTCTGGAAGAGG + Intergenic
1107384640 13:39894680-39894702 TGTGTTTCCCACTGTTGATGGGG - Intergenic
1108058727 13:46511348-46511370 TTTTCTTCCCACAGTGGATGGGG - Intergenic
1109370439 13:61414641-61414663 TTTGCTTCCCCCTAAGGGAGGGG - Intronic
1110405155 13:75142889-75142911 CATGCTTCCCACTGTGGAACTGG + Intergenic
1110797488 13:79657173-79657195 TTTGATTCCCAGTGTTGGAGTGG + Intergenic
1110960013 13:81609458-81609480 ATTGTTTTCCACTGTGGTAGGGG - Intergenic
1111807839 13:93059859-93059881 TTTGCTTCCATCTATGAAAGGGG - Intergenic
1112073243 13:95878326-95878348 TCTTCTTTCCACTTTGGAAGTGG - Intronic
1115579990 14:34748086-34748108 TTTGCTTCCTCCTGGTGAAGTGG + Intergenic
1115961312 14:38837936-38837958 CCTGCTTCCCTGTGTGGAAGAGG - Intergenic
1117225648 14:53655824-53655846 TTTTCTTCCTACTGTGGATGTGG + Intergenic
1120271785 14:82322016-82322038 CTTGCTTGGCTCTGTGGAAGTGG + Intergenic
1123153558 14:106204321-106204343 TTTGCCTCCCTCTGAAGAAGAGG - Intergenic
1123224779 15:17012343-17012365 TTAGATTCCTACTGTGGAAAAGG + Intergenic
1124657016 15:31516900-31516922 CTTGCTTCCCATTGTGGCGGTGG + Intronic
1125256651 15:37771738-37771760 TCTGCCTCACACTGTGCAAGGGG - Intergenic
1126869064 15:52968271-52968293 TTTTCTTCTCAGTGTGGTAGAGG - Intergenic
1128285666 15:66435005-66435027 TGTGCTCCCCACTTTGGAACAGG + Exonic
1128330344 15:66751506-66751528 TCAGTTTCCCATTGTGGAAGAGG - Intronic
1130545939 15:84857726-84857748 TCTGACACCCACTGTGGAAGTGG + Exonic
1132230752 15:100182062-100182084 TTTGCTTTCCACTGTGCATTAGG + Intronic
1133505527 16:6408507-6408529 TCTGCTTCCCACCATGGAATGGG - Intronic
1135385782 16:22038276-22038298 TTTGCAACCCACTGTGAATGAGG - Intronic
1136077196 16:27825263-27825285 CTTGTTTCCCACTGTGGACCAGG - Intronic
1137002355 16:35240424-35240446 TTTGCTTCAAACAGTGGAGGGGG - Intergenic
1137081518 16:36064810-36064832 TTTGAGTCCTACTGTGGAAAAGG + Intergenic
1139350160 16:66329827-66329849 TTTGGGTCCCACTGGGGAGGGGG + Intergenic
1139431670 16:66914068-66914090 ATTACTTCCCACTGTGGACTGGG - Intronic
1140318270 16:73921154-73921176 GTTTCTTCCCACAGTGGCAGTGG - Intergenic
1140491581 16:75341329-75341351 TTTGAATCCCACTGTGGACTAGG - Intronic
1140930484 16:79623114-79623136 CTCCCTTCCCACTGTGGGAGGGG - Intergenic
1141216280 16:82027225-82027247 TTGGCTGACCAATGTGGAAGGGG + Intergenic
1143577644 17:7803936-7803958 TCTGTTTCCCACTGTGGAACAGG - Intronic
1144074778 17:11707560-11707582 TTTCCTCCCCAGTCTGGAAGGGG + Intronic
1145290701 17:21543334-21543356 TTTGATTCCCAATGTTGAAAGGG - Intronic
1147137421 17:38442297-38442319 TCTGGTTCCCTCTGAGGAAGGGG + Intronic
1147353193 17:39868255-39868277 TCTGCTCCGCACTGTGGAGGAGG + Exonic
1149674402 17:58446571-58446593 GTTTCTTCCCACTGTGGCAGTGG - Intronic
1151715547 17:75829280-75829302 TTTGCTTCCCTTGGGGGAAGGGG - Intronic
1156102998 18:33621061-33621083 TTTGCATCCTAATGTGGTAGGGG - Intronic
1156378172 18:36532989-36533011 TGGGCTTCCCACAGTGGGAGGGG + Intronic
1157482597 18:48065072-48065094 TCTGCCTCCCACTGAGGAAGAGG + Intronic
1160235754 18:77085412-77085434 TTTCTCTCCCACTGTGGAATAGG + Intronic
1160524964 18:79530342-79530364 TTCGCTTCCCTCTGCCGAAGCGG + Intergenic
1160864723 19:1251619-1251641 CTTGGTACCCACCGTGGAAGCGG + Exonic
1163498834 19:17663434-17663456 CTTGCTTCCCTGTGTGGTAGTGG + Intronic
1164354724 19:27409740-27409762 TTTGCTGCCTACAGTGGAAAAGG - Intergenic
1164556952 19:29260526-29260548 TTTGCTTCCCACTGGACAATGGG + Intergenic
1165979175 19:39705356-39705378 TGTTCTTCCCATTGTGGAACAGG + Intronic
1166913234 19:46176252-46176274 TTTGTTCCTCTCTGTGGAAGAGG - Intergenic
1167274006 19:48524196-48524218 TTCACTTCCCAATGGGGAAGTGG - Intergenic
926235546 2:11040642-11040664 ATAGCTTCCCACATTGGAAGGGG - Intergenic
926637688 2:15200497-15200519 TTTGACACTCACTGTGGAAGGGG - Intronic
928006398 2:27566040-27566062 TTTTCTTCCCACTGTGGATCTGG - Exonic
931162498 2:59708051-59708073 TTTGCCTCACATTGTGGAAGGGG - Intergenic
932622397 2:73272632-73272654 TTTGCTTTGCCCTGTGGCAGAGG + Intronic
934016578 2:87892101-87892123 TTTGCTTTGCACTGTGGACTCGG + Intergenic
934490122 2:94756635-94756657 TCTGCTTCCCAGTGGGGAAGGGG + Intergenic
937178586 2:119968096-119968118 TTTGCTTACCCCTGTGCTAGAGG - Intronic
937348466 2:121143172-121143194 TTTGCTTCCTTCTCTGGATGGGG + Intergenic
938072460 2:128315931-128315953 TCTGCCACCCACTCTGGAAGTGG - Intronic
939211974 2:139187329-139187351 TTTGCTTTCCAATGTTGGAGGGG + Intergenic
940128371 2:150353590-150353612 TTTGTTCCGTACTGTGGAAGTGG - Intergenic
941029546 2:160494359-160494381 TTTGCCTCCCCTTGTGCAAGGGG - Intergenic
942331825 2:174833911-174833933 TGTGGTTCCCACTGCGTAAGAGG - Intronic
942392841 2:175514025-175514047 TATGCTTCCCAGTGTAGAACTGG - Intergenic
944321590 2:198350660-198350682 TTTACTTATCACTGTGGAACTGG + Intronic
1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG + Intergenic
1170381112 20:15760561-15760583 CTTGCTTCCCACTGCGGAATAGG + Intronic
1171469161 20:25356260-25356282 TTTGCTTCCCACGGGGGCACAGG + Intronic
1171735031 20:28769566-28769588 TTTGCTTCCTATAGTGGAAAAGG - Intergenic
1171826221 20:29910340-29910362 TTTGCTGCCTACGGTGGAAAAGG + Intergenic
1173885174 20:46451165-46451187 TTTGCTTCCTTCTCTGGAACAGG + Intergenic
1174784471 20:53419653-53419675 TTGACTGCCCGCTGTGGAAGGGG - Intronic
1175967309 20:62666037-62666059 TTGGCTTCCCACTGGGGCAGGGG + Intronic
1176322583 21:5348039-5348061 TTTGCTACCTATTGTGGAAAAGG + Intergenic
1176480235 21:7279659-7279681 TTTGCTACCTATTGTGGAAAAGG + Intergenic
1176658871 21:9614640-9614662 TTTGATTCCCGCTGCGGACGAGG - Intergenic
1180031026 21:45208034-45208056 CTTGCTTAGCACTGTGGAAGAGG + Intronic
1180325501 22:11372845-11372867 TTTGAGTCCTACTGTGGAAAGGG + Intergenic
1180396262 22:12345058-12345080 TTTGATTCCTATTGTGGAAAAGG - Intergenic
1180403451 22:12519035-12519057 TTTGATTCCTATTGTGGAAAAGG + Intergenic
1181256692 22:21567595-21567617 TGTGCTTCCCACTGTGCTGGGGG - Intronic
1181365754 22:22375939-22375961 TTTTCTTCCCACTGTTGCAGAGG - Intergenic
1203330929 22_KI270738v1_random:87875-87897 TTTGATGCCTACTGTGGAAAAGG - Intergenic
949555326 3:5147614-5147636 CATGGTTTCCACTGTGGAAGAGG - Intronic
949704410 3:6799390-6799412 TTTGCTCCCCACTATCCAAGAGG - Intronic
951561237 3:23968886-23968908 TTTGCTTCCTACTGTGTAAAGGG + Intronic
952829479 3:37552481-37552503 TTTTCTTCTCATTTTGGAAGGGG + Intronic
954806161 3:53222162-53222184 TGTGCTTCTCACTGTGCTAGAGG - Intergenic
955176021 3:56613474-56613496 TTGGTTCCCCTCTGTGGAAGAGG + Intronic
957346905 3:78972771-78972793 TTTGCTTACCACTGTGATCGAGG - Intronic
957441657 3:80255549-80255571 TCTGCTTCACACTCTGCAAGGGG + Intergenic
957943885 3:87038035-87038057 TCTGGTCCCTACTGTGGAAGGGG - Intergenic
958542087 3:95491028-95491050 TTTGGTTCCCACAGTCAAAGTGG - Intergenic
958821937 3:98985233-98985255 ATTTCTTCCCACTTGGGAAGTGG + Intergenic
959465075 3:106675984-106676006 GTTTCTTCCCAATGTGGAAGTGG - Intergenic
960588776 3:119345584-119345606 TTTGCTTCCCACTGTGTCCTTGG + Intronic
962705131 3:138035977-138035999 TTAGCTACCCACTGTGGCAGGGG - Intergenic
963003954 3:140708516-140708538 TGTGTTCCCCACTGGGGAAGGGG - Intergenic
963078065 3:141366710-141366732 TTTCCTTCCCACTGTGGGTGGGG - Intronic
965055290 3:163705239-163705261 GCTACTTTCCACTGTGGAAGTGG - Intergenic
966154519 3:176901609-176901631 TTGACTTCCCACTAAGGAAGAGG - Intergenic
966385466 3:179393055-179393077 TTTCTTCCCCACTGTGGAAGAGG + Exonic
966446228 3:180004510-180004532 TTTGGGTCCCACTGTAGAACTGG - Intronic
966698560 3:182819431-182819453 TTCACTTGCAACTGTGGAAGTGG + Intronic
967742776 3:193021487-193021509 TTTTCTTCTGAATGTGGAAGAGG + Intergenic
968053213 3:195670583-195670605 TTTGCTTGTCACTGAGAAAGGGG + Intergenic
968102600 3:195977778-195977800 TTTGCTTGTCACTGAGAAAGGGG - Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969470651 4:7385615-7385637 TTTGCTTCCCAATGTGGGGCAGG - Intronic
969968556 4:11022331-11022353 TTTGCCTGGCACTGTGGGAGGGG + Intergenic
970826442 4:20281569-20281591 TTTCTTTCCCTCTGTTGAAGGGG + Intronic
972472095 4:39415806-39415828 ATTGCTTAACACTGTGAAAGTGG + Intronic
973571119 4:52240755-52240777 TTTGCTTGCAAGTGGGGAAGAGG + Intergenic
973650017 4:52989655-52989677 TATGTTTCCCACTGTGGCATTGG + Intronic
973713204 4:53649815-53649837 TCTGCTTCCCACAGTGGACTGGG + Intronic
974148333 4:57973462-57973484 TCTGCCCCCCACTGTGGAATGGG + Intergenic
975365691 4:73524855-73524877 TCTGCTTTCCACTGTGATAGTGG + Intergenic
976091274 4:81460555-81460577 TTTGCATCTCAATGTGGGAGGGG + Intronic
976741087 4:88358293-88358315 TTTGCACCCCACTGGGGCAGGGG - Intergenic
979267940 4:118725276-118725298 TTTGCTTCCCCATGTAGGAGTGG - Intronic
979792434 4:124802271-124802293 TTTGTAGCCCACTTTGGAAGAGG - Intergenic
985416454 4:189740788-189740810 TTTGATTCCCGCTGCGGACGAGG + Intergenic
985499464 5:232931-232953 TTTGCTTGTCACTGAGAAAGGGG + Intronic
985988573 5:3537289-3537311 TTTGTTTCCCTCTGTGAAACTGG - Intergenic
987090111 5:14502900-14502922 ATTGCTTCCCTCTGTGAATGTGG + Intronic
987117599 5:14738046-14738068 TCTTCTGCCCAGTGTGGAAGAGG - Intronic
987324342 5:16798875-16798897 TCTGCTTGCAACTGAGGAAGAGG - Intronic
988363608 5:30267553-30267575 TTTCCTTCACATGGTGGAAGGGG - Intergenic
989432354 5:41370752-41370774 TATGCCTCCCTCTGTGAAAGAGG + Intronic
989859140 5:46343448-46343470 TTTGTTTCCCATGGTGGAAAAGG - Intergenic
989945691 5:50225063-50225085 TTTGCTGCCTATTGTGGAAATGG - Intergenic
991076922 5:62550615-62550637 TATGCTTCCCTGTGTGGAACAGG - Intronic
991392581 5:66163219-66163241 TTGTCTTCCCAGTGTGGAAGGGG + Intronic
992938689 5:81739511-81739533 CTTGCTACCCAGTGTGGTAGTGG + Intronic
994568355 5:101482851-101482873 TTTGCTTCCCACCCAGGTAGTGG - Intergenic
995182698 5:109244024-109244046 TTTGGTTGTCACAGTGGAAGAGG - Intergenic
995256020 5:110047863-110047885 TTTGCATCCCTCTTGGGAAGTGG - Intergenic
995949926 5:117699249-117699271 TTGACCTCCCACTGTGGATGAGG + Intergenic
996088009 5:119323760-119323782 TTTGCTTCCCAGTGGGGAACAGG + Intronic
996457967 5:123707017-123707039 TTTTCTGCCTACTGTGGAAGGGG - Intergenic
996565479 5:124875691-124875713 TTTCTTCCCCACTGTGGAAGAGG - Intergenic
997064794 5:130547862-130547884 CATGGTTTCCACTGTGGAAGAGG - Intergenic
998071436 5:139200902-139200924 CTTGCTTCACATGGTGGAAGGGG - Intronic
998407625 5:141882991-141883013 TTTGCTGCCTCCTGAGGAAGGGG + Intergenic
998567481 5:143229160-143229182 TTTGCTTTCCATTTAGGAAGAGG + Intergenic
998601858 5:143592726-143592748 TCTCCTTCCCACAGTGGGAGAGG + Intergenic
1001543984 5:172558714-172558736 CTGCCTTCCCAGTGTGGAAGGGG - Intergenic
1004150940 6:13119622-13119644 TCTGCTTCCTACTGAGGAGGAGG + Intronic
1005698279 6:28372114-28372136 TGTGCTTACCAGTGTGGAACAGG + Intergenic
1006275653 6:33003523-33003545 TTTACCTCCTGCTGTGGAAGAGG - Intergenic
1007182290 6:39938197-39938219 TTTGATCCCCAGTGTGGCAGTGG + Intergenic
1007695100 6:43726850-43726872 TTTGCTTCCCATGGTGGAGATGG + Intergenic
1008016859 6:46530277-46530299 TTTACTTTCTCCTGTGGAAGAGG - Intergenic
1013443830 6:110200476-110200498 TGAGCTTCCCACTTTGGAAAGGG - Intronic
1015116187 6:129651949-129651971 TGTCCTTCACATTGTGGAAGAGG - Intronic
1015381256 6:132571948-132571970 TCTGCTTCCCACTTTGGGGGAGG - Intergenic
1017073232 6:150595093-150595115 GTTGATTGTCACTGTGGAAGGGG - Intergenic
1017542675 6:155418674-155418696 GACGCTTCCCACTGAGGAAGTGG + Intronic
1017712574 6:157183516-157183538 TTTGATTCCCACTTGGGAACAGG - Intronic
1019016429 6:168883792-168883814 TGATCTTCCCAGTGTGGAAGTGG + Intergenic
1020591720 7:10147405-10147427 TTTATTTCCCACTGTAGAAGAGG - Intergenic
1021517810 7:21506565-21506587 CATGGTTTCCACTGTGGAAGAGG - Intronic
1021801953 7:24316184-24316206 TTTGTCTCCCTCTGTAGAAGGGG - Intergenic
1023302422 7:38787806-38787828 TTTGCCTCCTGCTGTGGAAATGG + Intronic
1025994081 7:66517299-66517321 TTTGGTGCCCACTCTGGCAGTGG - Intergenic
1026528553 7:71176791-71176813 TTTGCTTCCCTCCGTGGAGCTGG + Intronic
1027526384 7:79274443-79274465 ATTGCTTCCCTGTGGGGAAGCGG - Intronic
1027980889 7:85220398-85220420 TTTGTTTCCCCCTGGGGAAGAGG - Intergenic
1028057158 7:86260398-86260420 TTTGTTGCCCTCTGTGGAAATGG + Intergenic
1029049486 7:97669687-97669709 TTTGTTTCCCACTCTAGAATGGG + Intergenic
1029108463 7:98197224-98197246 TTTGCTTCCCCATGTGGGGGTGG + Intronic
1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG + Intronic
1030014565 7:105205748-105205770 TTTTCCTCCCGCTGGGGAAGTGG - Intronic
1030149209 7:106386110-106386132 ATGGATTCCCACTGTGGAGGTGG - Intergenic
1030273291 7:107693030-107693052 CTTGCATCTCACTGTGGATGGGG - Intronic
1030785394 7:113654265-113654287 TTTTCTTCCCACTGTGTACCAGG - Intergenic
1032112920 7:129091992-129092014 TTTTCTTCTCATTCTGGAAGAGG - Intergenic
1032662528 7:134001073-134001095 TATGCTTCAAACTGTGGAAAGGG - Intronic
1032739758 7:134727095-134727117 CTTGCTTCCCACTGTAGAAGTGG - Intergenic
1035067258 7:156115777-156115799 GTTGGTTCCCTCTGTGGACGGGG - Intergenic
1035632385 8:1117824-1117846 AGTGCTGCCCACTGTGAAAGGGG - Intergenic
1036397174 8:8379194-8379216 TTTGCTTCCAACTATGCCAGAGG + Intronic
1036492798 8:9243518-9243540 GCTGCTTCCCAATGTGGAAAGGG + Intergenic
1037246732 8:16844022-16844044 TTTGATTACCAGTGTGTAAGGGG - Intergenic
1038413042 8:27373180-27373202 TGGGCTCCCCACTGTGGCAGGGG - Intronic
1040996539 8:53408153-53408175 TTTGCTCCACCCTGTGGAAAGGG + Intergenic
1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG + Intronic
1042900175 8:73717487-73717509 ATTGTTTCCAACTGTGGAAAAGG + Intronic
1043017556 8:74959052-74959074 CTTGCTTCTCTCTGTTGAAGAGG + Intergenic
1043377851 8:79669982-79670004 GTTGCTGGTCACTGTGGAAGAGG + Intergenic
1043941876 8:86205236-86205258 TGTGATTCCCAATGTGGAGGTGG + Intergenic
1044533908 8:93338413-93338435 TTTGTTTCCCCCTTTGCAAGAGG + Intergenic
1045019928 8:98033380-98033402 TATGCTTCCAACACTGGAAGTGG - Intronic
1045063203 8:98425801-98425823 TGTACTTCCCACTGTGGCAGTGG + Intronic
1048946582 8:139454025-139454047 TCTGCTTCCCACTGAGGATGAGG + Intergenic
1051026255 9:12615314-12615336 TGTGTTCCTCACTGTGGAAGTGG + Intergenic
1051589752 9:18765575-18765597 TTTGTTTCCCAGTAAGGAAGTGG - Intronic
1053917463 9:42954181-42954203 TCTGCTTCCCAGAGGGGAAGGGG - Intergenic
1054756094 9:68959550-68959572 TTTTGTTCTCACTTTGGAAGAGG + Intronic
1055657647 9:78468088-78468110 TTTGGTTCCTACTGGGGATGTGG - Intergenic
1056860319 9:90175160-90175182 GGAGCTTCCCACTGTGGGAGAGG - Intergenic
1057753510 9:97810816-97810838 TGTGCTTCCCACAGTGGAAAAGG + Intergenic
1059817005 9:117927831-117927853 TTTGTTTGCCCCTGTGCAAGGGG + Intergenic
1060779686 9:126402266-126402288 ATTTCTTGCCACTATGGAAGTGG - Intronic
1062631132 9:137463643-137463665 TGAGCTTCCCTCTGTGGAGGCGG - Intronic
1062703267 9:137919240-137919262 TCTGCTCACCACTGTGTAAGCGG - Intronic
1203378347 Un_KI270435v1:2715-2737 TTTGAGTCCCACGGTGGAAAAGG + Intergenic
1203384189 Un_KI270438v1:4964-4986 TTAGATTCCTATTGTGGAAGAGG + Intergenic
1203384475 Un_KI270438v1:10753-10775 TTAGATTCCTACTGTGGAAAAGG + Intergenic
1203373414 Un_KI270442v1:339057-339079 TTTGCGGCCCATTGTGGAAAAGG + Intergenic
1203400207 Un_KI270519v1:82258-82280 TTTGAGTCCTATTGTGGAAGAGG + Intergenic
1203636617 Un_KI270750v1:118247-118269 TTTGATTCCCGCTGCGGACGAGG - Intergenic
1186340491 X:8640362-8640384 TTTGCTTGCCACTGTGAAGGTGG - Intronic
1187260566 X:17681937-17681959 TTTGTTCCCCACTATGGATGAGG - Intronic
1187941575 X:24387812-24387834 TCTGCATCTCACTGAGGAAGTGG - Intergenic
1188465153 X:30471389-30471411 TTTTCCACCCACAGTGGAAGAGG + Intergenic
1188642837 X:32527881-32527903 TGTGTCTCCCTCTGTGGAAGGGG + Intronic
1189783315 X:44536600-44536622 TTGGCTTCCCATTATGGAATGGG - Intronic
1190982505 X:55468467-55468489 TTTAATTGTCACTGTGGAAGGGG - Intergenic
1190986194 X:55504716-55504738 TTTAATTGTCACTGTGGAAGGGG + Intergenic
1191270504 X:58460586-58460608 TTTGCTTCCTATTGTGAAAAAGG - Intergenic
1191567055 X:62552994-62553016 TTTGAGTCCTACTGTGGAAAAGG + Intergenic
1191568081 X:62566759-62566781 TTTGAGTCCTACTGTGGAAAAGG + Intergenic
1191568965 X:62582236-62582258 TTTGCTGCCTACGGTGGAAAAGG + Intergenic
1191568991 X:62582754-62582776 TTTGCTGCCTATTGTGGAAAAGG + Intergenic
1191569070 X:62584296-62584318 TTTGGTACCTACTGTGGAAAAGG + Intergenic
1193473272 X:81933099-81933121 TTTGATTCCCAATCTTGAAGGGG + Intergenic
1195670230 X:107463529-107463551 TATACTTCCCACTTTGGTAGAGG + Intergenic
1195747162 X:108130295-108130317 TTCTTTTCCCAGTGTGGAAGTGG - Intronic
1196064244 X:111445199-111445221 TTTCTATCCCGCTGTGGAAGAGG - Intergenic
1198462779 X:136879591-136879613 ATTGCTTCCTACTGTGGCTGAGG - Intronic
1199127908 X:144146439-144146461 TTTGCTTTGCACTGTGGACTCGG - Intergenic
1199840954 X:151648360-151648382 TTTGCTCCCCACTGTTAAAAAGG + Intronic
1201096510 Y:10624163-10624185 TTTGATTCCTATTGTGGAAAAGG - Intergenic