ID: 911149311

View in Genome Browser
Species Human (GRCh38)
Location 1:94581823-94581845
Sequence GCATCCAGGAAGACACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911149311_911149316 -1 Left 911149311 1:94581823-94581845 CCCTCCAGTGTCTTCCTGGATGC No data
Right 911149316 1:94581845-94581867 CTGATTTTCACTGTACTTGTGGG No data
911149311_911149317 6 Left 911149311 1:94581823-94581845 CCCTCCAGTGTCTTCCTGGATGC No data
Right 911149317 1:94581852-94581874 TCACTGTACTTGTGGGCTGTTGG No data
911149311_911149315 -2 Left 911149311 1:94581823-94581845 CCCTCCAGTGTCTTCCTGGATGC No data
Right 911149315 1:94581844-94581866 GCTGATTTTCACTGTACTTGTGG No data
911149311_911149318 15 Left 911149311 1:94581823-94581845 CCCTCCAGTGTCTTCCTGGATGC No data
Right 911149318 1:94581861-94581883 TTGTGGGCTGTTGGTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911149311 Original CRISPR GCATCCAGGAAGACACTGGA GGG (reversed) Intergenic
No off target data available for this crispr