ID: 911153563

View in Genome Browser
Species Human (GRCh38)
Location 1:94618402-94618424
Sequence CACTTTTAGCTATATGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911153563_911153569 1 Left 911153563 1:94618402-94618424 CCAAGTTCATATAGCTAAAAGTG No data
Right 911153569 1:94618426-94618448 CAGGGTTGGGACATGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911153563 Original CRISPR CACTTTTAGCTATATGAACT TGG (reversed) Intergenic
No off target data available for this crispr