ID: 911154726

View in Genome Browser
Species Human (GRCh38)
Location 1:94626386-94626408
Sequence GTAAGCTAATTGGCCAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911154724_911154726 -6 Left 911154724 1:94626369-94626391 CCATCAGTTGCTTGGCAGTAAGC No data
Right 911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG No data
911154722_911154726 20 Left 911154722 1:94626343-94626365 CCTGGGTGGAGGAACGAGGTTAC No data
Right 911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911154726 Original CRISPR GTAAGCTAATTGGCCAAGTG AGG Intergenic
No off target data available for this crispr