ID: 911155727

View in Genome Browser
Species Human (GRCh38)
Location 1:94635031-94635053
Sequence AATCCCCAGTGATGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911155727_911155735 13 Left 911155727 1:94635031-94635053 CCCCCAGGGCATCACTGGGGATT No data
Right 911155735 1:94635067-94635089 GCCCCCTCATTCTTCCTGCTGGG No data
911155727_911155737 14 Left 911155727 1:94635031-94635053 CCCCCAGGGCATCACTGGGGATT No data
Right 911155737 1:94635068-94635090 CCCCCTCATTCTTCCTGCTGGGG No data
911155727_911155733 -9 Left 911155727 1:94635031-94635053 CCCCCAGGGCATCACTGGGGATT No data
Right 911155733 1:94635045-94635067 CTGGGGATTTCTGTATGGGAAGG No data
911155727_911155734 12 Left 911155727 1:94635031-94635053 CCCCCAGGGCATCACTGGGGATT No data
Right 911155734 1:94635066-94635088 GGCCCCCTCATTCTTCCTGCTGG No data
911155727_911155742 30 Left 911155727 1:94635031-94635053 CCCCCAGGGCATCACTGGGGATT No data
Right 911155742 1:94635084-94635106 GCTGGGGCTGAAACAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911155727 Original CRISPR AATCCCCAGTGATGCCCTGG GGG (reversed) Intergenic