ID: 911160706

View in Genome Browser
Species Human (GRCh38)
Location 1:94680119-94680141
Sequence GGGTCCTGACCACAGTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911160703_911160706 -5 Left 911160703 1:94680101-94680123 CCAGGTTTGGTACCTCCTGGGTC No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160692_911160706 26 Left 911160692 1:94680070-94680092 CCTCCTTAACTCATCTCCCAGCT No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160702_911160706 -4 Left 911160702 1:94680100-94680122 CCCAGGTTTGGTACCTCCTGGGT No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160696_911160706 9 Left 911160696 1:94680087-94680109 CCAGCTCCCTTTTCCCAGGTTTG No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160699_911160706 2 Left 911160699 1:94680094-94680116 CCTTTTCCCAGGTTTGGTACCTC No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160691_911160706 27 Left 911160691 1:94680069-94680091 CCCTCCTTAACTCATCTCCCAGC No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160695_911160706 10 Left 911160695 1:94680086-94680108 CCCAGCTCCCTTTTCCCAGGTTT No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160693_911160706 23 Left 911160693 1:94680073-94680095 CCTTAACTCATCTCCCAGCTCCC No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data
911160698_911160706 3 Left 911160698 1:94680093-94680115 CCCTTTTCCCAGGTTTGGTACCT No data
Right 911160706 1:94680119-94680141 GGGTCCTGACCACAGTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911160706 Original CRISPR GGGTCCTGACCACAGTCCCG TGG Intergenic
No off target data available for this crispr