ID: 911160941

View in Genome Browser
Species Human (GRCh38)
Location 1:94682904-94682926
Sequence CCTCCCAATTCCCAAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911160941_911160949 12 Left 911160941 1:94682904-94682926 CCTAGGGCTTGGGAATTGGGAGG No data
Right 911160949 1:94682939-94682961 ATGACTGAGGAAATTCTTTTTGG No data
911160941_911160950 30 Left 911160941 1:94682904-94682926 CCTAGGGCTTGGGAATTGGGAGG No data
Right 911160950 1:94682957-94682979 TTTGGAGTGATAAAAATGTTTGG No data
911160941_911160948 -1 Left 911160941 1:94682904-94682926 CCTAGGGCTTGGGAATTGGGAGG No data
Right 911160948 1:94682926-94682948 GATTGGGGGAAGGATGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911160941 Original CRISPR CCTCCCAATTCCCAAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr