ID: 911161303

View in Genome Browser
Species Human (GRCh38)
Location 1:94685317-94685339
Sequence CCTGGGACACTGCTTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911161303_911161311 20 Left 911161303 1:94685317-94685339 CCAGTGGAAAGCAGTGTCCCAGG No data
Right 911161311 1:94685360-94685382 CAGATAACTAGAAACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911161303 Original CRISPR CCTGGGACACTGCTTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr