ID: 911162755

View in Genome Browser
Species Human (GRCh38)
Location 1:94698036-94698058
Sequence GAGCCAGATGGCCCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911162755_911162760 0 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162760 1:94698059-94698081 AAAGGTTAGTTAAAGGAGGTAGG No data
911162755_911162761 1 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162761 1:94698060-94698082 AAGGTTAGTTAAAGGAGGTAGGG No data
911162755_911162763 19 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162763 1:94698078-94698100 TAGGGTAAACAGACTTAATTGGG No data
911162755_911162764 20 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162764 1:94698079-94698101 AGGGTAAACAGACTTAATTGGGG No data
911162755_911162759 -4 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162759 1:94698055-94698077 GCTCAAAGGTTAGTTAAAGGAGG No data
911162755_911162762 18 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162762 1:94698077-94698099 GTAGGGTAAACAGACTTAATTGG No data
911162755_911162758 -7 Left 911162755 1:94698036-94698058 CCTCACAGAGGGCCATCTGGCTC No data
Right 911162758 1:94698052-94698074 CTGGCTCAAAGGTTAGTTAAAGG 0: 25
1: 23
2: 14
3: 17
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911162755 Original CRISPR GAGCCAGATGGCCCTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr