ID: 911163258

View in Genome Browser
Species Human (GRCh38)
Location 1:94702568-94702590
Sequence GAGTCACTCATTGCCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911163252_911163258 4 Left 911163252 1:94702541-94702563 CCCTGACCTCGGCCAGTGCTGAA No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163249_911163258 18 Left 911163249 1:94702527-94702549 CCTTCCTCAGGAGGCCCTGACCT No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163244_911163258 30 Left 911163244 1:94702515-94702537 CCTTGTTCCCAGCCTTCCTCAGG No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163255_911163258 -2 Left 911163255 1:94702547-94702569 CCTCGGCCAGTGCTGAAAAAGGA No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163256_911163258 -8 Left 911163256 1:94702553-94702575 CCAGTGCTGAAAAAGGAGTCACT No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163248_911163258 22 Left 911163248 1:94702523-94702545 CCAGCCTTCCTCAGGAGGCCCTG No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163247_911163258 23 Left 911163247 1:94702522-94702544 CCCAGCCTTCCTCAGGAGGCCCT No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163251_911163258 14 Left 911163251 1:94702531-94702553 CCTCAGGAGGCCCTGACCTCGGC No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data
911163253_911163258 3 Left 911163253 1:94702542-94702564 CCTGACCTCGGCCAGTGCTGAAA No data
Right 911163258 1:94702568-94702590 GAGTCACTCATTGCCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911163258 Original CRISPR GAGTCACTCATTGCCCTGGC TGG Intergenic
No off target data available for this crispr