ID: 911170743

View in Genome Browser
Species Human (GRCh38)
Location 1:94768801-94768823
Sequence CTGCCAGAGGGGCCCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911170737_911170743 11 Left 911170737 1:94768767-94768789 CCTGAGCAGAAACACACTGTATT No data
Right 911170743 1:94768801-94768823 CTGCCAGAGGGGCCCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911170743 Original CRISPR CTGCCAGAGGGGCCCCTGAA GGG Intergenic
No off target data available for this crispr