ID: 911176317

View in Genome Browser
Species Human (GRCh38)
Location 1:94821001-94821023
Sequence GGAAATGCACAGATACGGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911176310_911176317 12 Left 911176310 1:94820966-94820988 CCCTAGGCAAAGGGAGTGGCGAC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
911176309_911176317 13 Left 911176309 1:94820965-94820987 CCCCTAGGCAAAGGGAGTGGCGA 0: 1
1: 0
2: 0
3: 13
4: 84
Right 911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
911176313_911176317 -10 Left 911176313 1:94820988-94821010 CCCCAGATTTATAGGAAATGCAC 0: 1
1: 0
2: 0
3: 22
4: 155
Right 911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
911176311_911176317 11 Left 911176311 1:94820967-94820989 CCTAGGCAAAGGGAGTGGCGACC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG 0: 1
1: 0
2: 2
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911176317 Original CRISPR GGAAATGCACAGATACGGCA TGG Exonic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900956229 1:5887912-5887934 GGCCATGCACAGAGAGGGCAGGG + Intronic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
907306166 1:53514245-53514267 CCAAATGCACAGATGAGGCAAGG + Intronic
908661921 1:66445881-66445903 GGAGATGAACAGAGACTGCAGGG + Intergenic
910139729 1:84013860-84013882 GAAAATGTACATATACGCCATGG + Intergenic
910719312 1:90268436-90268458 GGAAAAGAACAGATAAGGCTTGG + Intergenic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911235049 1:95403502-95403524 GGAAATGGACAGAGATGGCCAGG + Intergenic
912226888 1:107744081-107744103 GGAAATGCAAAGCTCAGGCAGGG + Intronic
918213353 1:182371263-182371285 GGAAATGCAAAGCTGCTGCAAGG - Intergenic
919557866 1:199083310-199083332 GGAACTGCACAGCCACAGCATGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1065402502 10:25322085-25322107 AGAAAATCACAGATACGGCCAGG + Intronic
1065812106 10:29451761-29451783 GGAACTGCAAAGATCCAGCAGGG - Intergenic
1065959678 10:30724400-30724422 GGAACTGCAAAGATCCGGCAGGG + Intergenic
1065978151 10:30862234-30862256 TGAGCTGCACAGATATGGCATGG + Intronic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1071361230 10:84848072-84848094 GGAAAAGCACAGATATTGCTCGG + Intergenic
1072758898 10:98039853-98039875 GGAATTGCAGAGATATGGGAAGG - Intergenic
1074124419 10:110516768-110516790 AAAAATGCACAGATACTTCAAGG - Intergenic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1076327192 10:129634356-129634378 GCAAATGCACAGATACAAGATGG - Intronic
1077454298 11:2669068-2669090 GTAAAGACACTGATACGGCAGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1081636315 11:44724862-44724884 GCTAATGCACAGATAGGGCCAGG + Intergenic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1082989226 11:59192928-59192950 GGAAATGCTCAGACACTGTAAGG - Intronic
1083192908 11:61065388-61065410 TGAAATACACTGACACGGCAGGG + Intergenic
1085169406 11:74435767-74435789 GGAAATGGACATATATGTCAGGG - Intergenic
1085846693 11:80074129-80074151 GGAAAAGCCCAGAAACGACATGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1090538704 11:127676411-127676433 GGAAATGCACTAATACAGTATGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092942271 12:13420922-13420944 GGAACAGCACAGAAGCGGCATGG - Intergenic
1099577920 12:84404095-84404117 GGAAATGATCAGATACCTCAGGG + Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1104493173 12:129212348-129212370 GGAAATACACAGAGGAGGCAGGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1110758724 13:79206658-79206680 GGAACTGCAGAGAGATGGCATGG - Intergenic
1112824465 13:103375968-103375990 GAAAATGTACATATACGGCATGG + Intergenic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1119928934 14:78525519-78525541 GGCAGTGCACAGATAGGGCTGGG - Intronic
1120836709 14:89044941-89044963 GCAAAGTCACAGATACTGCAAGG - Intergenic
1126815250 15:52447672-52447694 GGATATGCACAGTGAAGGCAAGG + Intronic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1128675085 15:69602633-69602655 GGAAATGCACAGACTTGGAAGGG - Intergenic
1129572532 15:76703809-76703831 GGGAATGCAGAGATAAGGCATGG - Intronic
1130014270 15:80175026-80175048 GTCATGGCACAGATACGGCAGGG - Exonic
1136933182 16:34436675-34436697 GCAAATGCACAAAGCCGGCAGGG - Intergenic
1136971390 16:34975139-34975161 GCAAATGCACAAAGCCGGCAGGG + Intergenic
1138379303 16:56589358-56589380 GGCAGTGCACACACACGGCAGGG + Exonic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1141878607 16:86842987-86843009 GGAAAGGCAGAGATGGGGCAGGG + Intergenic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1147335632 17:39725532-39725554 GGAAGTGCACAGACCCTGCAAGG - Intronic
1148006221 17:44432364-44432386 GGGAAGGCAGAGATACGACAAGG + Intronic
1148665651 17:49372610-49372632 GGAAATGCCCCAATACTGCATGG + Intronic
1148846687 17:50533833-50533855 GGAAGGGCACAGAGAGGGCAGGG - Intronic
1149160790 17:53690332-53690354 GCAAATGTACAGACAAGGCAAGG + Intergenic
1151893420 17:76964393-76964415 GGAAAAGCAAAGAAAAGGCACGG + Intergenic
1152281905 17:79389844-79389866 GGCCATGCTCAGATACTGCAGGG + Intronic
1152802211 17:82336036-82336058 AGAAATGGAAAGATACGGCCGGG - Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1158359387 18:56654423-56654445 AGAAATACTCAGATTCGGCAGGG - Intronic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1166743669 19:45129745-45129767 GGAGAGGCACAGGTACGGCAGGG - Intronic
925964391 2:9050285-9050307 TGATATGCACAGATAATGCAAGG - Intergenic
927333488 2:21893122-21893144 GGAAATGTACACATACACCATGG - Intergenic
927412813 2:22845917-22845939 GGAAAAGAACAGATAAGGTAGGG + Intergenic
928381512 2:30822307-30822329 GGAAATGAAGGGTTACGGCAAGG + Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
936772400 2:115930054-115930076 AGAAATGAACAGATCCAGCAAGG - Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937906928 2:127056969-127056991 TGGAATGCCCAGATACAGCAGGG - Intronic
944151407 2:196562583-196562605 GGAAATGCAGTGATAAGGCTGGG - Intronic
945221107 2:207485341-207485363 GGAGATACAGAGATACGGGAGGG - Intergenic
946553939 2:220833683-220833705 GGAAATGCAAATATACCGCATGG + Intergenic
948811127 2:240478958-240478980 GGAAATTCACGGAGAGGGCAGGG - Intergenic
1169158038 20:3350663-3350685 GGAAATGTAAAGATAAGGCTGGG + Intronic
1169314484 20:4577194-4577216 GGCATTTCACAGATACGTCAAGG + Intergenic
1169682243 20:8228441-8228463 GGGGATGCACAGAGAAGGCAAGG - Intronic
1172641856 20:36445208-36445230 TGAAATGCACAGATTTGGCCAGG + Intronic
1180995391 22:19962929-19962951 GGATATGCCCAGATAGGGCTGGG + Intronic
1182489940 22:30664843-30664865 GGACAAGCACAGAGACAGCAGGG + Intronic
1184674222 22:46031852-46031874 GGAAAAGCAGAGAAAAGGCAAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
952392568 3:32892913-32892935 GGAACTCCACAGAAAGGGCAGGG + Exonic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
954984868 3:54781181-54781203 GGGAATGCAGAGACACAGCAAGG + Intronic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
962334205 3:134511335-134511357 GGAAATCCACAGAGAAGTCAAGG - Intronic
963623692 3:147644518-147644540 GGAATTGCAGAGATAAGGCCTGG + Intergenic
965773440 3:172204984-172205006 GGAAATGGAGAGAGACGGGAAGG + Intronic
965983569 3:174723458-174723480 AGAAATGCCCAGATAGGGCTGGG + Intronic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
968360885 3:198145895-198145917 GGTTATGCACACACACGGCAAGG + Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
974713267 4:65631192-65631214 GAAAATGCACAGTGAAGGCAGGG - Intronic
975422733 4:74187845-74187867 GGAAATACACAGGCACGGAATGG - Intronic
977000117 4:91487878-91487900 AGATATGCACAGATATGACATGG + Intronic
977801181 4:101234104-101234126 GAAAATGTACATATACGCCATGG - Intronic
981710861 4:147707833-147707855 AGAAATGCACAGAAATGGCCGGG - Intergenic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
982793585 4:159620304-159620326 AGAAATGCACAGATAAGCCTAGG - Intergenic
984159719 4:176237164-176237186 TGAAATGCACATGTATGGCATGG - Intronic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
986078523 5:4364028-4364050 GGAGATGCACCGTTACGGCATGG - Intergenic
986862552 5:11944338-11944360 GGAAATACAGATATACGGAAGGG - Intergenic
991229398 5:64313514-64313536 GGAAATGTACACATACACCATGG - Intronic
992361079 5:76038892-76038914 GTAAATGCTCAGATAAGCCATGG + Intergenic
993910570 5:93678102-93678124 GGAAATTCACTGATAAGGGATGG + Intronic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
1000003193 5:157159671-157159693 GGAAATGCAGAGAAAGTGCATGG + Intronic
1002899994 6:1402360-1402382 GGAAAGGCACGGACACGCCACGG + Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1005786554 6:29250584-29250606 GGACCTGCACAGATAGGACACGG + Intergenic
1013418933 6:109948970-109948992 GGAAAGGAACAGATGAGGCAGGG + Intergenic
1014569512 6:122991708-122991730 GGAAACTCAGAGATACGGGAAGG + Intergenic
1016147498 6:140694093-140694115 GGAAATGATCAGATACCTCAGGG - Intergenic
1017162446 6:151378448-151378470 GGAGAGGCACAGAAAAGGCATGG + Intronic
1017466941 6:154703212-154703234 GGAGAGGCACAGAGAAGGCAGGG - Intergenic
1022328926 7:29359521-29359543 GGAAAGGAACAGAGAGGGCAGGG - Intronic
1023880804 7:44320256-44320278 GGAAAAGCACAAATACATCATGG + Intronic
1024118332 7:46213412-46213434 GGAAAGGAACAGGTAGGGCAGGG + Intergenic
1025847932 7:65217253-65217275 GGCAATGCACAGATCCGGGGGGG - Intergenic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1028695669 7:93708400-93708422 GAAAATACACACATACGCCATGG + Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033813261 7:145042879-145042901 GGAAATTCAAAGCTAAGGCAAGG - Intergenic
1040332143 8:46391148-46391170 GGAAAAGCAGAGAGACTGCAGGG + Intergenic
1040340160 8:46436391-46436413 GGAAAAGCGACGATACGGCATGG - Intergenic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1045188629 8:99862047-99862069 GGAAATGCTCAGAGAAGGTAAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057478088 9:95421670-95421692 GGAAAGCCACAGTTACAGCATGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1062745590 9:138209726-138209748 GGTTATGCACACACACGGCAAGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1188497986 X:30798766-30798788 GGCAAAGCACAGACAAGGCAAGG - Intergenic
1188759031 X:34002506-34002528 TGAAATGCACAGATAGGCCTAGG + Intergenic
1188901699 X:35740569-35740591 GGAAATGCACAGAGATAACATGG - Intergenic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190790153 X:53691658-53691680 GAAAATGCACAGCTCTGGCAAGG - Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1197679669 X:129368760-129368782 TGAAATGTACAGATATCGCATGG - Intergenic
1200326344 X:155244028-155244050 GTAAATGAATAGATACGGCATGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic