ID: 911178098

View in Genome Browser
Species Human (GRCh38)
Location 1:94837472-94837494
Sequence TTTAGGTTTTTGGTTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 808}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911178091_911178098 23 Left 911178091 1:94837426-94837448 CCTTAAATATGTGCAATTTTTAT 0: 5
1: 107
2: 767
3: 2029
4: 3900
Right 911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG 0: 1
1: 0
2: 3
3: 72
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911178098 Original CRISPR TTTAGGTTTTTGGTTTCTGT GGG Intronic
901235649 1:7666243-7666265 TTTTGGTTTTTGGTTTTGTTTGG - Intronic
902575837 1:17376831-17376853 ACTAAGTTTTTGGTTTGTGTGGG + Intronic
902748128 1:18487091-18487113 TGTAGATTTTTGTTTTCTGTTGG + Intergenic
902853118 1:19177343-19177365 TTTAGGTTTTAGGTTTTGGTAGG - Intronic
905138717 1:35823057-35823079 TTTATGTTTTTTGTGTGTGTTGG - Intronic
906049563 1:42859077-42859099 TTGAGGTTTTTGTGTGCTGTAGG - Intergenic
906098987 1:43244216-43244238 TTCAAGTTTTTGTTTTCTGGTGG + Intronic
906179736 1:43807947-43807969 TTTAGGTTTTAAGTGTCTGTAGG + Intronic
906481461 1:46202102-46202124 TTTAGTTTTTTTTTTTCTTTTGG - Intronic
906571401 1:46844660-46844682 TTTTTGTTTTTGCTTTTTGTGGG - Intergenic
906599869 1:47116582-47116604 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
906901581 1:49842270-49842292 TTCAGGCTTCTGGTCTCTGTAGG + Intronic
908283544 1:62568689-62568711 TTTGGGTTTTTTGTTGTTGTTGG - Intronic
908647575 1:66295439-66295461 TTTTGTTTTTTGTTTTCTGACGG + Intronic
909171692 1:72303652-72303674 TATACTTGTTTGGTTTCTGTGGG + Intergenic
909663632 1:78110342-78110364 TTCAAATTTTTGGTTTCTCTTGG - Intronic
909764213 1:79334427-79334449 CTTAGGTTTTGAGTGTCTGTGGG + Intergenic
909966533 1:81918824-81918846 TTTAGTTTTCTGGATTTTGTTGG + Intronic
909999149 1:82321504-82321526 TTTTGGTTTTTGGTTCTTTTTGG + Intergenic
910051359 1:82977943-82977965 TCTTGGTTTTGGGTTTCGGTGGG + Intergenic
910548544 1:88449265-88449287 TGTAGGTTTGTGGGTTTTGTGGG + Intergenic
910676838 1:89822974-89822996 TTGGGGTGTTTGGTCTCTGTAGG + Intronic
910683620 1:89893082-89893104 TTTATGTTTTTGGTTGCTTATGG - Intronic
910726523 1:90345615-90345637 TTTAGGATTTTCTTCTCTGTTGG + Intergenic
910902904 1:92141979-92142001 TTTAGATTTTTGTTTTGGGTAGG + Intronic
910905895 1:92177594-92177616 TTTAGGTTTTTGTTTTTTGAAGG - Intronic
910949357 1:92629335-92629357 ATCAGGTTTTTGGATTCAGTAGG + Intronic
911122266 1:94308588-94308610 TTTTTGGTTTTTGTTTCTGTTGG + Intergenic
911163317 1:94702985-94703007 TTTTGGTTTTTAGATTCTTTGGG - Intergenic
911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG + Intronic
911363648 1:96910537-96910559 ATTTTGGTTTTGGTTTCTGTGGG - Intergenic
911774788 1:101794952-101794974 TATGTGTTTTTGGTTTCTGCAGG - Intergenic
911849768 1:102803327-102803349 CTTTGGTTTTTAGTATCTGTGGG - Intergenic
911949955 1:104160617-104160639 CCTATTTTTTTGGTTTCTGTTGG - Intergenic
912018191 1:105069250-105069272 TTTTGTTTTTTGGTTTCCATTGG + Intergenic
912329859 1:108809527-108809549 TTCTGGTTTGTGTTTTCTGTAGG + Intergenic
912409782 1:109472780-109472802 TTTTTGTTTGTAGTTTCTGTAGG + Intronic
912860872 1:113212773-113212795 TTTAGGTTTCTGCTATCTGCTGG - Intergenic
913083757 1:115414817-115414839 TTTATGTTTTTGGTTTTTTGAGG - Intergenic
913086754 1:115445380-115445402 ATTATGTTTGTGGATTCTGTGGG - Intergenic
913361441 1:117985180-117985202 TTTTTGTTTTTGGTTTGTTTGGG - Intronic
913696762 1:121333905-121333927 TTGGGGTTTTTGGTTTATTTAGG + Intronic
914140798 1:144946155-144946177 TTGGGGTTTTTGGTTTATTTAGG - Intronic
914806530 1:150996035-150996057 TTTTTGTTTTTGTTTTCTATGGG - Intergenic
915099978 1:153492110-153492132 TTTTGGTTTTTGTTTTGTTTTGG + Intergenic
915122557 1:153639774-153639796 TTTATGTTTTTGGTTTGGTTTGG + Intronic
915647687 1:157285601-157285623 TTCAGATCTTTGTTTTCTGTGGG + Intergenic
916370360 1:164087321-164087343 TTGAGATTTTTCCTTTCTGTTGG - Intergenic
916813515 1:168327811-168327833 TTTTGGTTTTTGGTTTTTTGGGG - Intergenic
917390948 1:174536039-174536061 TGTATATTTGTGGTTTCTGTAGG + Intronic
917756872 1:178110318-178110340 CTGAGGATTTTGGTATCTGTTGG - Intronic
917811975 1:178667906-178667928 TTGAAGTTTTTAGTTTCTGGTGG + Intergenic
918412664 1:184276269-184276291 TTTTGATTTTTAATTTCTGTGGG - Intergenic
918663538 1:187118949-187118971 TTTTGTTTTTTGTTTTCTTTTGG - Intergenic
919217966 1:194585092-194585114 TTTATGTTTTTGATTTTTGAGGG + Intergenic
919673936 1:200362741-200362763 TTTGGGTTGTTGGGTTTTGTGGG + Intergenic
919823448 1:201487401-201487423 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
919903308 1:202059852-202059874 TTTATGTTTTTGGTTATCGTGGG + Intergenic
920484093 1:206352259-206352281 TTGGGGTTTTTGGTTTATTTAGG + Intronic
920834737 1:209499576-209499598 TTTCGGATTTTGGTTTTTCTCGG + Intergenic
921163637 1:212490676-212490698 TTTAGGTTTTTAGATTCAGAAGG + Intergenic
922955917 1:229599985-229600007 TTTACCTGTTTGGTTTCTCTAGG + Intronic
923007436 1:230062560-230062582 TCTATGATTTTGGTTACTGTAGG + Intronic
923385541 1:233462165-233462187 TTTCTGTTTTTGTTTTCTGCAGG + Intergenic
923657458 1:235930510-235930532 TTTTTGTTTTTGTTTTTTGTGGG + Intergenic
924029765 1:239874510-239874532 TTGAGGATTTTGGTATCTGCAGG + Intronic
924072156 1:240291941-240291963 TTTTGGTTTGGGGTTTTTGTGGG - Intronic
924112092 1:240710315-240710337 TTTTGATTTTTAGTTTGTGTGGG + Intergenic
924516829 1:244773237-244773259 TTTTTGTTTTTGGTTTTTGGGGG + Intergenic
924583277 1:245340173-245340195 TTGTGGATTTTAGTTTCTGTAGG - Intronic
924695086 1:246390973-246390995 TTTTGATTTTTGTTTTCTATAGG - Intronic
1062865058 10:845381-845403 TTTAGGGTTTGTGTTTGTGTAGG - Intronic
1063896333 10:10686291-10686313 TTTGGGTTTTTGGATTTTTTGGG + Intergenic
1064157165 10:12912484-12912506 GTTGGGTGTTTGGTTTCTTTTGG + Intronic
1064367107 10:14717996-14718018 TTTTGGTTCTTGGTTCCTGGGGG + Intronic
1065041128 10:21697460-21697482 TTTTGGTTTTTGTTTTCAGATGG - Intronic
1065729086 10:28694177-28694199 TTTTGATTTTTGTTTTTTGTAGG - Intergenic
1065822881 10:29542526-29542548 TTTAAATTTTTAATTTCTGTGGG + Intronic
1066402224 10:35087637-35087659 TCTGGGTTTTTGGCTTCTGCTGG - Intronic
1067229010 10:44394079-44394101 GTTTGGTTTTTGGTTGCTTTGGG + Intergenic
1067516800 10:46955107-46955129 CTGAGGATTTTGGTATCTGTGGG + Intronic
1067645451 10:48096719-48096741 CTGAGGATTTTGGTATCTGTGGG - Intergenic
1068785598 10:60969199-60969221 TTTAGGTTTTTTGTTTGTTTTGG - Intronic
1069044480 10:63728057-63728079 TTTTGTTTTTTGGTTTTTTTTGG - Intergenic
1069132674 10:64726497-64726519 TTTTGGTTTTTGTTTTTTTTGGG + Intergenic
1069254951 10:66321322-66321344 TTTAGTTTTTATGTTTCTTTCGG - Intronic
1069781084 10:70956050-70956072 TCTAAGTTTTCGGTTACTGTTGG + Intergenic
1070143240 10:73754567-73754589 TTGTGGATTTTGGTATCTGTTGG - Intronic
1070180783 10:74011450-74011472 TTTAGACTGTTGGTTTCTGAAGG + Intronic
1070412630 10:76156947-76156969 TTTAGGTTCTTGGTGCCTGGAGG + Intronic
1071112690 10:82178628-82178650 TTTAGGTTTTTTATATCTCTTGG + Intronic
1071461331 10:85899708-85899730 TTTAGGTTTCTGCTTGCTGTGGG - Intronic
1073394162 10:103204452-103204474 TTTTGGTTTTTTGTTTTTTTGGG - Intergenic
1073455279 10:103633002-103633024 TTTTGTTTTTTGGTTTTTTTTGG - Intronic
1073994354 10:109298423-109298445 TTTATGTTTTATGTTTATGTTGG + Intergenic
1074550150 10:114435352-114435374 TTTTGCTTTTTGGTTTTTTTTGG + Intronic
1074606366 10:114972597-114972619 TTTAGGTTTTTATTATCTTTTGG + Intronic
1074664738 10:115707886-115707908 TTGATGTTTTTGATATCTGTTGG + Intronic
1074711578 10:116182435-116182457 TTTAGGCTTTTGACTTCTGGGGG - Intronic
1075123541 10:119681738-119681760 TTTTGGTTTGTGTTTTCTGTAGG - Intergenic
1075133622 10:119762724-119762746 TTGAGGATTTTGGTATCTATAGG + Intronic
1075176537 10:120168502-120168524 TTTTGGTATTTGTTTTATGTTGG + Intergenic
1075179692 10:120199064-120199086 TGTAGGTTTGTGGTTTATTTTGG + Intergenic
1075868875 10:125753170-125753192 TTAAGTTTTTTTGTTGCTGTTGG + Intronic
1076482067 10:130791444-130791466 TGTATGTTTTTGGTGTGTGTGGG - Intergenic
1076812204 10:132893008-132893030 TTTAGGTTTTTTATGTCTCTTGG - Intronic
1077062191 11:622455-622477 TTTTGGTTTTTGGGTTTTTTTGG + Intronic
1077497703 11:2894403-2894425 TTTGGGTTTTTGCTTTTTGGGGG + Intronic
1077946015 11:6899373-6899395 ATTAAGTATTTGGTTTCTGAAGG + Intergenic
1078300371 11:10124389-10124411 TTTGGGTTTCTGCTTTCTCTAGG - Intronic
1078347057 11:10559522-10559544 TTTTGGTTCTTTGTTTTTGTTGG - Intronic
1078765205 11:14290007-14290029 TTTAGTTTTTTGTCATCTGTAGG - Intronic
1078941204 11:16008011-16008033 CTGAGGATTTTGGTATCTGTAGG - Intronic
1079405954 11:20145917-20145939 TTTGGGTTTTTTCTGTCTGTTGG + Intergenic
1079742754 11:24084469-24084491 TTTACCTTTATTGTTTCTGTGGG - Intergenic
1079950348 11:26794150-26794172 TTTATTTTTTTTTTTTCTGTTGG - Intergenic
1080200256 11:29660737-29660759 TTTAGGCTTCTTGTTTCTTTGGG - Intergenic
1081466111 11:43319262-43319284 TTTTGTTTTTTGGTTTTTGGGGG + Intronic
1081786682 11:45752549-45752571 TTTAGTTTTTTTGTTTTTGGGGG + Intergenic
1081835291 11:46148794-46148816 TTTTGTTTTTTGGTGTCCGTGGG + Intergenic
1082201528 11:49376893-49376915 TTTCAGTTTTTGTTCTCTGTGGG + Intergenic
1082969374 11:59003363-59003385 TTTAGGTCTTTTGATTCTTTGGG - Intronic
1083077467 11:60055852-60055874 TTTTGTTTTTTGGTTTTTTTAGG - Intergenic
1083385716 11:62308206-62308228 TTTTGGTTTTTTATTTTTGTGGG + Intergenic
1083512215 11:63220469-63220491 TTTAAATTTTTAGTTTTTGTGGG + Intronic
1084163209 11:67362264-67362286 ATTAGGTTTTAGGCTTCTTTTGG + Intronic
1084964731 11:72738679-72738701 TGTATGTTCTTGGTTCCTGTTGG - Intronic
1085600539 11:77852330-77852352 TTTGGTTTATTTGTTTCTGTTGG + Intronic
1085707155 11:78796654-78796676 TTTAGGTTTTTTCTGTCTTTGGG - Intronic
1085900503 11:80694069-80694091 ATTAGGTTTTTTGTTTATTTTGG - Intergenic
1086035903 11:82414261-82414283 ATTAAGTTTTGGTTTTCTGTGGG - Intergenic
1086101809 11:83108434-83108456 TTTGGGTTTTTTGTTTGTTTTGG + Intergenic
1086360386 11:86052735-86052757 TATAGCTTTTTGGCTACTGTAGG - Intronic
1086498290 11:87426213-87426235 TTAAGGATTGTTGTTTCTGTGGG + Intergenic
1087045145 11:93838479-93838501 TTTTTGTTTTTGTTTTTTGTGGG - Intronic
1087399495 11:97647034-97647056 TATATGTTTTTGGTTTATGTAGG - Intergenic
1087518005 11:99190768-99190790 TTTATTTTTTTGGTTTTTGGTGG + Intronic
1087613237 11:100458757-100458779 TTGATGGTTTTTGTTTCTGTGGG + Intergenic
1087970826 11:104480775-104480797 TTTAGATTTTTTGTTTCTTCTGG - Intergenic
1088144411 11:106658032-106658054 CTGAGGATCTTGGTTTCTGTGGG + Intergenic
1088159526 11:106853351-106853373 TTTTGGTTTTTTGTTTTTATTGG + Intronic
1089483276 11:118824506-118824528 TTGTGGATTTTGGTATCTGTGGG - Intergenic
1090122546 11:124047504-124047526 TTTAAGTTTTTAATTTTTGTGGG + Intergenic
1090800987 11:130172096-130172118 TTTTGTTTTTTTGTTTCTTTTGG + Intronic
1091437961 12:487950-487972 TTTGGGTTTTTTGTTTGTTTTGG - Intronic
1091992446 12:4966586-4966608 TTTTTGTTTTTGTTTTTTGTTGG - Intergenic
1092461547 12:8691304-8691326 TTAAAGTTTTTGGTTTTTGTAGG + Intronic
1092835468 12:12483939-12483961 TTTAAGTTTTAGGGATCTGTGGG - Intronic
1093041076 12:14380265-14380287 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
1093123757 12:15303942-15303964 TTTAGTTTTTTAGTTTTTATGGG - Intronic
1093294442 12:17370695-17370717 CTAAGTTTTTTGGTTTCTATGGG + Intergenic
1093304414 12:17495669-17495691 TGTACATTTTTGGTTTCTGTTGG + Intergenic
1093336702 12:17913249-17913271 TTTATTCTTTTGGTTTCTGTTGG + Intergenic
1093475399 12:19549043-19549065 ATTTGGTTTTCTGTTTCTGTGGG + Intronic
1093648443 12:21616226-21616248 TTTTTGTTTTTGTTTTCTGATGG + Intergenic
1093916580 12:24809000-24809022 TTTATATTTTTAATTTCTGTGGG + Intergenic
1094095714 12:26702369-26702391 TTGAGGTTTTTGGTTTGGTTTGG + Intronic
1094192045 12:27707928-27707950 TTCAGGTTTTTTGTATCTATTGG - Intergenic
1094457817 12:30658423-30658445 TTTAGGTTTTTTTTGTCTTTAGG + Intronic
1095480079 12:42625608-42625630 TTTTGGTTTCTGGTTTTCGTGGG - Intergenic
1096559811 12:52428034-52428056 ATCAGGTTTTAGGTTTCTATGGG + Intronic
1096605761 12:52764938-52764960 GTTAGGTTTTTGGTTGGGGTGGG + Intergenic
1097375829 12:58841300-58841322 CTTAGGTTGCTGGGTTCTGTGGG + Intergenic
1097815951 12:64073511-64073533 CTTCGGGTTTTGGTATCTGTGGG - Intronic
1097945184 12:65359824-65359846 TCTAGGTTTTTGGCTTTTATTGG + Intronic
1098194922 12:67989645-67989667 TTTAGGTTTTTAGCTCCTGTGGG + Intergenic
1099034097 12:77564017-77564039 TTTTGATTTTTGTTTTCTTTTGG + Intergenic
1099244944 12:80183384-80183406 TTTTGGCTTTTTGTTTCTTTTGG + Intergenic
1099355911 12:81635414-81635436 ATTAGGTTTATGGATTCTTTGGG + Intronic
1099430402 12:82577342-82577364 TCTAGGTTTATGGTCTCTCTGGG - Intergenic
1099984009 12:89641797-89641819 TTTTAGTTTTTGGTTTCTTTTGG - Intronic
1100233948 12:92638441-92638463 TTTGAGTTTTTTTTTTCTGTAGG - Intergenic
1100678187 12:96891134-96891156 TTTAGGTTTGAGGTGCCTGTGGG + Intergenic
1100758268 12:97776600-97776622 TTTAGTTTTTTCCTTTCTGTTGG + Intergenic
1100804405 12:98266353-98266375 ATTGGGTTTTGGTTTTCTGTGGG - Intergenic
1101041225 12:100757832-100757854 TTTGCTTTTATGGTTTCTGTAGG + Intronic
1101169500 12:102075345-102075367 TTTAATTTTTTGTTTTTTGTAGG + Intronic
1101407194 12:104439014-104439036 TTCAGGTTTTTCTTTTCTATAGG - Intergenic
1101555941 12:105809621-105809643 TTTAAATTTTTGATTTTTGTGGG - Intergenic
1101676983 12:106926160-106926182 TCTAGGTTTTTGGTTTTCTTGGG + Intergenic
1102227736 12:111240799-111240821 TTTGGGTTTTTGCTCTCTGGAGG + Intronic
1103662122 12:122528645-122528667 CCTAGGGTTTTGGTATCTGTGGG - Intronic
1105327026 13:19380131-19380153 GTTTGGTTTTTGTTTGCTGTTGG + Intergenic
1105513028 13:21066934-21066956 TTTTTGTTTTTCGTTTTTGTTGG + Intergenic
1105620855 13:22064837-22064859 TTTAGGTTTTGTGGTTTTGTTGG + Intergenic
1105929025 13:25034461-25034483 TTTTGGTTTTTTTTTTCTTTTGG + Intergenic
1106004351 13:25754995-25755017 TTTGGGTTTTTTGTTGTTGTTGG + Intronic
1106366010 13:29081716-29081738 TTTATATTTTGGGTATCTGTAGG + Intronic
1107291855 13:38863817-38863839 TTTATTTTTTTGTTTTTTGTAGG + Intronic
1108254756 13:48599230-48599252 TTTAGGTTTATGGTTTGCTTTGG - Intergenic
1109259536 13:60127484-60127506 TATATGTTTTTGTTTTTTGTGGG - Intronic
1110052267 13:70919074-70919096 TTTAGGGTTTTGCTTTATATAGG + Intergenic
1110181770 13:72625972-72625994 TTTAGGACTGTGGGTTCTGTGGG + Intergenic
1110871143 13:80453359-80453381 TTTATGTTTTTAGTTTGTTTTGG - Intergenic
1111027337 13:82547598-82547620 TCTAGATTTTTTGTTTCAGTTGG + Intergenic
1111098848 13:83553663-83553685 ATTATGTCTTTGTTTTCTGTGGG + Intergenic
1111135170 13:84032390-84032412 TTTAGTTTTTTGTTTTGTGCTGG + Intergenic
1111209528 13:85059771-85059793 TTTATGTTTTTGTGTTCTGTTGG - Intergenic
1112532277 13:100216670-100216692 TCTTGGTTTTTGGTTTCTTTTGG - Intronic
1112853422 13:103734957-103734979 TTCTGGTTTCTGGTTTCTGAAGG + Intergenic
1112866948 13:103914755-103914777 TTTATGTCTTTGGTTTGTTTAGG - Intergenic
1113120358 13:106917949-106917971 TCTAGGGTTTTGCTTCCTGTAGG - Intergenic
1113486769 13:110658994-110659016 TTTAGGTGTTTGGATTATGTAGG + Intronic
1113994586 14:16055718-16055740 TTTGGGTTTTTGGGTTCCGAGGG + Intergenic
1114259802 14:21028215-21028237 CTTAGGTTTTTTGTTTCTTGGGG + Intronic
1114705405 14:24721392-24721414 TTTGGGTCTTTGATTTCTTTTGG + Intergenic
1114829283 14:26119981-26120003 TTTAGGTTTTGGGATTCTGTGGG + Intergenic
1115050586 14:29056958-29056980 TTTTGTTTTTTGTTTTTTGTTGG - Intergenic
1115337552 14:32256975-32256997 TTTTGGTTTTAGGTTTTTTTTGG + Intergenic
1115716065 14:36104879-36104901 TTTAGGTTTTTTCTTTGGGTTGG + Intergenic
1115723844 14:36191698-36191720 ATTAGGTGTTTGGTTTCGATAGG + Intergenic
1116141515 14:41001393-41001415 TTTAGTTTTTTGGTTTTTTTGGG + Intergenic
1117138870 14:52765999-52766021 TTTATGTTTTTGTTTTTTGAGGG + Intronic
1117139143 14:52768529-52768551 TTTAAGTTTTTGGTGTTTTTTGG + Intronic
1117175008 14:53136863-53136885 TATATGTTTTTGGATTATGTAGG - Intronic
1117324848 14:54659468-54659490 TTTTTGTTTTTGGTTTCTGAGGG + Intronic
1117405166 14:55394990-55395012 TTTAGTTTCTTGTTTTCTGCAGG + Intronic
1117600676 14:57371271-57371293 TTTTGGTTGTGGTTTTCTGTAGG - Intergenic
1118024387 14:61754068-61754090 TTTGGTTTTTGGGTTTTTGTGGG + Intergenic
1118073873 14:62277206-62277228 TTTATTTTTTTGGTTTGTGGGGG + Intergenic
1118350264 14:64968660-64968682 TCTAGGTTATGGGCTTCTGTGGG + Intronic
1118470382 14:66069718-66069740 TTTAGGTTTCTGTTTTCTTCAGG + Intergenic
1118989722 14:70786888-70786910 TTTAGTTTTTTGGTTTTTCTTGG + Intronic
1119034781 14:71220310-71220332 CTTGGATTTTTGGTTTCTTTTGG + Intergenic
1119345222 14:73917913-73917935 TTGTGGATTTTGGTATCTGTGGG - Intronic
1119969722 14:78956571-78956593 TTTAGGTATTTGGATCCTTTTGG + Intronic
1120013340 14:79442481-79442503 TTTTTGTTTTTGTTTTCTATAGG - Intronic
1120245247 14:81998519-81998541 TTTAGTTTTTTGGCTGCTCTAGG + Intergenic
1120432112 14:84432413-84432435 TTTTTGTTTCTGGTTTCTGATGG - Intergenic
1121089660 14:91172238-91172260 TTTATGGTTTTGGTTTTTTTTGG + Intronic
1121657066 14:95604928-95604950 TTTTGGTTTTTGGGCTCTCTTGG + Intergenic
1124547737 15:30647222-30647244 TTTTTGTTTTTTGTTTCTTTGGG + Intronic
1124675699 15:31683649-31683671 TTTAATTTTTTTATTTCTGTGGG - Intronic
1124712187 15:32022907-32022929 TTTATGTTTTAGCCTTCTGTAGG - Intergenic
1124782085 15:32645702-32645724 TTTATTTTTTTAGTTTTTGTGGG - Intronic
1125020342 15:34978798-34978820 CTTGGATTTTTGGTATCTGTGGG - Exonic
1125261872 15:37835214-37835236 TTGAGTTTCTTGTTTTCTGTAGG - Intergenic
1125324296 15:38520991-38521013 TTTGGGTTTTTGTTTTGTTTTGG - Intronic
1125438838 15:39678901-39678923 TTTAGGTTTTTTAATTCTTTGGG + Intronic
1125445876 15:39755542-39755564 TTTTGGTTTTTAATTTCTGTTGG - Intronic
1125765714 15:42134198-42134220 TTTATGTATTTGGTGACTGTTGG - Intergenic
1126219806 15:46199431-46199453 TTTAGGTTTTTTTTTTTTGGTGG + Intergenic
1126408788 15:48350495-48350517 TCTAGGATTTTGGTATCTGCAGG + Intergenic
1126872980 15:53009583-53009605 TTTATGTTTTCAGTTTCTGTGGG - Intergenic
1126873926 15:53018116-53018138 TTTTGGTTTTTGTTTTGTTTTGG - Intergenic
1127096446 15:55516026-55516048 TTCTGGTTTTAGGTTCCTGTAGG + Intergenic
1127139162 15:55956127-55956149 TTTATGTTTTTAATTTTTGTGGG + Intronic
1127985105 15:64063514-64063536 TTTTGGTTTTTGTTTTTTTTTGG - Intronic
1128856548 15:71022372-71022394 TTTATTTTTTTGGTTTTTTTTGG - Intronic
1128857997 15:71036685-71036707 TTTTGGTTTTTGGGTTATTTTGG + Intronic
1128935172 15:71739997-71740019 TTTAGGTCTTTGGTTCTTCTTGG + Intronic
1129375558 15:75128331-75128353 TTTTGTTTTTTGGTTTTTTTTGG - Intergenic
1129547541 15:76412892-76412914 TTTAGGTCTTTAATTTCTCTCGG + Intronic
1129639488 15:77360349-77360371 TTTATTTTTTTGGTTGCTTTTGG - Intronic
1130187086 15:81694396-81694418 TTTATCTATTTGATTTCTGTTGG - Intergenic
1130895868 15:88170017-88170039 TTTAGGTCTTTGGCTTCAGTGGG - Intronic
1130962533 15:88672319-88672341 TTTTTGTTTTTAATTTCTGTGGG - Intergenic
1131022635 15:89112255-89112277 TCTAGATTTCTGGTTTCTCTTGG - Intronic
1131304349 15:91228412-91228434 TTGGGGTCTTTGGTTTTTGTTGG - Intronic
1132261653 15:100430329-100430351 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
1133083019 16:3338489-3338511 TCTTGGTTTTGGTTTTCTGTGGG + Intergenic
1133816878 16:9204232-9204254 TTTAGGCTGTTGGTTTATGTAGG + Intergenic
1133835086 16:9360816-9360838 CTAAGGATTTTGGTATCTGTAGG + Intergenic
1133872698 16:9704154-9704176 CTTAGGTTTGTGTTTTCTCTGGG + Intergenic
1134999981 16:18768846-18768868 TTTTTGTTTTTTGTTTCTTTAGG + Intergenic
1135032592 16:19050393-19050415 TTTAAGTTTTTTGTTTTTTTTGG - Intronic
1135590039 16:23698560-23698582 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1135765753 16:25176527-25176549 TTTTGGTTTTTGTTTTTTTTTGG + Intronic
1136359813 16:29771808-29771830 ATTAGTTTTTTAGTTTTTGTGGG + Intergenic
1136390300 16:29960158-29960180 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1136624034 16:31450767-31450789 TTTTGGTTTTTGGATTTTTTTGG - Intergenic
1137795215 16:51211558-51211580 TTTCTGTTTTTGTTTTCTTTGGG + Intergenic
1138052959 16:53801235-53801257 TTTTGGTTTTTTTTTTATGTTGG + Intronic
1138550643 16:57746253-57746275 TTTAGGTTCTAGGTTGCTATTGG + Intronic
1138680880 16:58682931-58682953 TTTAAATTTTTTGTTCCTGTGGG + Intronic
1138903970 16:61307874-61307896 GTTGGGTTTTTGGTTTTGGTTGG - Intergenic
1139764492 16:69215535-69215557 ATTAAGTTTTTAGTTTCTGTTGG - Intronic
1140447280 16:75040576-75040598 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1140466420 16:75186744-75186766 TTTTGGATTTTGGTATCTGCAGG + Intergenic
1140730348 16:77850646-77850668 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
1141168291 16:81675202-81675224 TTTTGGTTTTTGGGTTTTTTTGG + Intronic
1143399226 17:6631172-6631194 TTTGGTTCATTGGTTTCTGTTGG - Intronic
1143545916 17:7595458-7595480 TTTTGGTTTTTGGTTTTTTTGGG + Intronic
1144600748 17:16610640-16610662 TTTTGTTTGTTGGTTTTTGTGGG - Intergenic
1144799595 17:17916411-17916433 TTTAGGTCTTTGGTCTGTTTGGG + Intronic
1145229557 17:21163204-21163226 TTTTGTTTTTTGGTTTTTTTTGG - Intronic
1146239263 17:31201003-31201025 TAAAGGCTTTTGTTTTCTGTTGG + Intronic
1146414006 17:32615048-32615070 ATTATGTTCTTGGATTCTGTTGG - Intronic
1146754441 17:35415363-35415385 TTTAAGTCTTTGATTCCTGTTGG - Intronic
1146965355 17:37023854-37023876 TTGTGGATTTTGGTTTCTGCAGG - Intronic
1147289817 17:39432752-39432774 TTTTGGTTTTTGTTTTTTTTTGG - Intronic
1147294748 17:39473148-39473170 TGTTGGTTTTTGTTTTCAGTTGG + Intronic
1147548837 17:41423926-41423948 TTTGGGTTCTTGGTTTCTCTTGG - Intronic
1147550820 17:41440325-41440347 TTTGGGTTCTTGGTTTCTCTTGG - Intronic
1148061603 17:44840572-44840594 TTTAGGTTTTGGGGTTTTTTGGG - Intergenic
1148433987 17:47667110-47667132 TTTTGGTTTTTGGTTTTTTGGGG + Intronic
1149656950 17:58315050-58315072 TTTTGGTTTTTGATTTGGGTGGG + Intronic
1149704221 17:58680744-58680766 TTTGTTTTTTTGGTTTTTGTGGG - Intronic
1149968946 17:61196493-61196515 TTGGGGTTTTTTGTTTTTGTGGG - Intronic
1150506883 17:65708083-65708105 TTTAGATGTTTGGTTTGTGGTGG - Intronic
1150905851 17:69336370-69336392 TTTAGGGTTCTAGTTTATGTAGG - Intergenic
1150943455 17:69718822-69718844 TTTTAGCTTTTGGTTGCTGTTGG + Intergenic
1151332695 17:73420288-73420310 TTTATGTTTTTGCTTTTTGATGG + Intronic
1152428053 17:80229428-80229450 TTTTGTTTTTTGGTTTTTTTTGG + Intronic
1153193877 18:2571784-2571806 TTTTGGTGTTTGTTTGCTGTTGG + Intronic
1153431850 18:5026196-5026218 TTTTGTTTTTTTGTTTTTGTGGG + Intergenic
1153498991 18:5729268-5729290 TGAAGGTTTTTGGTTTGTATGGG - Intergenic
1153964963 18:10171220-10171242 TTTGGGTTTTTGGTCTCCATAGG + Intergenic
1154350779 18:13581649-13581671 TTTAGTTCTGTGGTTTCTATTGG + Intronic
1154413430 18:14156739-14156761 TAAAGGCTTTTGTTTTCTGTTGG - Intergenic
1155567611 18:27153406-27153428 TTTAGGTTTCTGGTGGCTCTAGG + Intronic
1155719895 18:28998657-28998679 TTTTGGTTTTTGTTTTTTGTTGG + Intergenic
1155740151 18:29279344-29279366 TTTAGGGTTTTTTTTTCAGTAGG - Intergenic
1156782154 18:40863324-40863346 TTTTGGTTCTTCGTATCTGTGGG - Intergenic
1157215603 18:45780763-45780785 TTTAGGTTTCTCTTTTCTCTTGG - Intergenic
1157640778 18:49211907-49211929 TTTAAGTTTTTGCTCTCTTTTGG - Intronic
1157704972 18:49798489-49798511 TTAATGTTTTTGGTTGTTGTTGG - Intronic
1158165002 18:54530377-54530399 TTTTGGTTTTTGCTTTCCCTTGG - Intergenic
1158172006 18:54610532-54610554 TATAGGATCTTTGTTTCTGTGGG + Intergenic
1158422703 18:57310133-57310155 TTGTGGATTTTGGTATCTGTAGG - Intergenic
1158714228 18:59863480-59863502 TTTTGGTTTTGGGTTTTTTTTGG - Intergenic
1159132800 18:64299605-64299627 TTTAAATTCTTGGTTTCTTTGGG + Intergenic
1159240900 18:65742264-65742286 TTTAGGTGTCAGGATTCTGTAGG - Intergenic
1159385391 18:67718215-67718237 TTTTTGTTTTTGGTTTTTTTTGG - Intergenic
1159547698 18:69860298-69860320 TTTGGATTTTTGGTTCTTGTAGG - Exonic
1159730712 18:72023831-72023853 ATTTGTTTTTTGTTTTCTGTTGG + Intergenic
1159901757 18:74053471-74053493 TTTAGTTTGTTGGACTCTGTGGG - Intergenic
1160249470 18:77188868-77188890 TTTAAATTTTAGCTTTCTGTTGG + Intergenic
1160293170 18:77613478-77613500 TTTGGGTTTCTCTTTTCTGTTGG - Intergenic
1160311678 18:77798020-77798042 TTTTAGTATTTGTTTTCTGTGGG + Intergenic
1160442757 18:78904769-78904791 TTTGGTTATTTGGTTTCTGCTGG - Intergenic
1160861406 19:1238562-1238584 TTTGGGCTTTGGGTTTCTGCGGG - Intergenic
1161158135 19:2745326-2745348 GTTTGGTTTTTGGTTTTTGGGGG + Intergenic
1161525127 19:4749722-4749744 TTTTGTTTTTTGGCTTTTGTGGG - Intergenic
1162429795 19:10621431-10621453 TTTTTTTTTTTGGTTTTTGTGGG + Intronic
1162832413 19:13294230-13294252 TTTAGTTTGTTGGTTTATTTAGG - Intronic
1164493030 19:28731544-28731566 TTTAGCTTTATGGCTTCTCTTGG - Intergenic
1164968002 19:32502636-32502658 TTGAGTTTATTGGTTTCAGTTGG + Intergenic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
1165262898 19:34636111-34636133 TTCAGGTTGTTGGTTTCTAATGG - Intronic
1165720752 19:38078011-38078033 TCTAGATTTCTGATTTCTGTTGG + Intronic
1168646411 19:58061685-58061707 TTCAGGCTTCTGGTCTCTGTGGG + Exonic
1202685875 1_KI270712v1_random:49545-49567 TTTATCTTTTTTGTTTATGTTGG - Intergenic
925486810 2:4343675-4343697 TTTAGGTTATTTATTTCTTTTGG + Intergenic
926528200 2:14008975-14008997 GTTATGTTTTTAGTTACTGTTGG + Intergenic
927578815 2:24223341-24223363 TTTATTTTTTTGTTCTCTGTGGG - Intronic
928081371 2:28315367-28315389 TTTATCTTTTTTTTTTCTGTAGG + Intronic
928184257 2:29095329-29095351 TTCAGGTTTTTTCTATCTGTGGG + Intergenic
928559050 2:32459727-32459749 TTTAGGTCTTTGATTTCTCTTGG + Intronic
928910566 2:36416744-36416766 TTTCTGTCTTTGGTTTCTGGAGG - Intronic
929116714 2:38450883-38450905 TATAGGTTTTTGTTGTCTTTAGG - Intergenic
929494107 2:42424581-42424603 ATCAGGTTTTTGTTTTCTCTTGG - Intronic
929844319 2:45506254-45506276 TTTAGGTTTTTATTCTCTATTGG + Intronic
930253526 2:49062907-49062929 TTTATGTTTTTGGTTTTGGGTGG - Intronic
930394580 2:50804894-50804916 TTTAAGTCTTTTGTTTCTTTGGG + Intronic
930644037 2:53884736-53884758 TATAGGTCTTTGGTGTATGTAGG - Intronic
930983141 2:57551966-57551988 TTTTGCTTTTTTGTTTTTGTAGG + Intergenic
931190602 2:59996530-59996552 ATGAGGTTTTTTGTTTTTGTGGG + Intergenic
931338949 2:61379507-61379529 TTTTGTTTTTTGGTTTTTCTTGG - Intronic
932129210 2:69172407-69172429 GTTAGGTTATCTGTTTCTGTGGG - Intronic
934104071 2:88680116-88680138 TTCAGGTTTTTTCTGTCTGTTGG - Intergenic
934104855 2:88686170-88686192 TTCAGGTTTTTTCTATCTGTTGG - Intergenic
935002310 2:99030657-99030679 TTTTGTTTTTTGTTTTCTTTTGG - Intronic
935735229 2:106101215-106101237 TTTGGGTTTTTGTTTTCTCCTGG - Intronic
936104227 2:109611473-109611495 GTTAGATTTTTTTTTTCTGTTGG - Intronic
936412546 2:112273578-112273600 TTAAGGTGTTTGGTTTGTGATGG - Intergenic
937351382 2:121165247-121165269 TTTAGGTCTTTAATTTCTCTTGG + Intergenic
937394646 2:121524276-121524298 TTTCTGTTTTTGTTTTCCGTGGG - Intronic
938412670 2:131077812-131077834 TTTTGGTTTTTGCTGTCTGCTGG - Intronic
938536885 2:132255036-132255058 TTTGGGTTTTTGGGTTCCGAGGG - Intronic
938818139 2:134925759-134925781 CTTGTGTTTTTGGTTTCTCTTGG + Intronic
938886997 2:135660235-135660257 TTCAGTTTTTTGGTTTTTTTTGG + Intronic
938906829 2:135845019-135845041 TTTATGCTTTTAGTTTCTGTTGG - Intronic
939029979 2:137061485-137061507 TATAGGTTTTTTTTTTTTGTAGG + Intronic
939373835 2:141338214-141338236 CTCAGAGTTTTGGTTTCTGTGGG + Intronic
939649142 2:144740526-144740548 TATAAGTTTTAGGTTTTTGTTGG + Intergenic
940341522 2:152586867-152586889 TTTAGGCTCCTGGCTTCTGTGGG + Intronic
940397024 2:153201364-153201386 TTTAGCTTTCCGTTTTCTGTAGG - Intergenic
940416617 2:153430264-153430286 TTTAATTTTTTTTTTTCTGTGGG + Intergenic
940831256 2:158468944-158468966 TTTTTGTTTTTGTTTTTTGTAGG + Intronic
941360546 2:164546431-164546453 ATTTGGTTTTGGTTTTCTGTTGG - Intronic
941378276 2:164758202-164758224 TTTAAGTTATTGGTATCTGAGGG - Intronic
941580405 2:167290852-167290874 TTTAGCTTTTTTGCTTCTGTAGG + Intergenic
941619253 2:167758085-167758107 AATAGGTTTTTGGTTTTTTTAGG + Intergenic
941670090 2:168283870-168283892 CTTAGCTTTTTTATTTCTGTGGG - Intergenic
941718235 2:168786339-168786361 TTCAGGTTTTTTCTGTCTGTCGG - Intergenic
941862089 2:170293180-170293202 ATTTGGTTTTGGTTTTCTGTGGG + Intronic
941932670 2:170957824-170957846 TTTAGTTTTTATGTTTTTGTAGG + Intronic
942086004 2:172444603-172444625 TTTGGGTTTTTGGTTTTTTTTGG - Intronic
942140463 2:172972373-172972395 GTTAGGGTTTTGATTTCTGCTGG + Intronic
942275613 2:174320920-174320942 TTTTGGATTTTGGCTTCTTTTGG + Intergenic
942547344 2:177078821-177078843 TTTGGGTTTCTGAGTTCTGTGGG - Intergenic
942638142 2:178031216-178031238 ATTAGGTATGAGGTTTCTGTGGG - Intronic
942919659 2:181356334-181356356 TTTGGGTTATTGGTTTCTCTAGG + Intergenic
942991004 2:182202638-182202660 TTTAGCATCTTGGTTTCTCTGGG - Intronic
943561770 2:189472574-189472596 TTTTTGTTTTTGGTTTGTCTTGG + Intronic
943709069 2:191069873-191069895 TTATGGTCTTTGGTTGCTGTTGG - Intronic
943926760 2:193793988-193794010 TTTTTGTTTTTGTTTTCTTTTGG - Intergenic
944325584 2:198400063-198400085 GTTAGATTTGAGGTTTCTGTGGG - Intronic
944563094 2:200961166-200961188 TTTGGGTTTTTTGTTTTTGTGGG + Intronic
944702205 2:202255832-202255854 TTTTGTTTTTTGGTTTTTTTTGG - Intergenic
944985013 2:205166637-205166659 TTTAGGGTTTTGGGTTTTTTGGG + Intronic
945232124 2:207602981-207603003 TTTGGCTTTTTGGTTTTTGAGGG + Exonic
945298371 2:208193192-208193214 TTTATGTTTTATGTTTTTGTGGG - Intergenic
945853771 2:215042235-215042257 TTTAGGTTTTATGTTTGTTTGGG + Intronic
946355926 2:219184803-219184825 TTTGGTTTTTTGTTTTTTGTGGG + Exonic
946683512 2:222243075-222243097 TTTAGGTTTTGTGTATCTTTCGG - Intronic
946784296 2:223226287-223226309 TTTGTGTGTGTGGTTTCTGTAGG - Intergenic
947245742 2:228046302-228046324 TTTTTTTTTTTGGTCTCTGTTGG + Intronic
948308816 2:236969905-236969927 TTGACATTTGTGGTTTCTGTCGG - Intergenic
948951323 2:241253739-241253761 TTTATGTTAGTGGCTTCTGTGGG - Intronic
948968662 2:241406315-241406337 TTTATGTTTTTGTTTTGTTTTGG - Intronic
1168875035 20:1165526-1165548 TTTAGAGTTTGAGTTTCTGTAGG + Exonic
1169401036 20:5280627-5280649 TTGATGTTTTTGCTTTTTGTTGG - Intergenic
1169676709 20:8163028-8163050 TTCAGGTTTCTGGTGTTTGTAGG + Intronic
1169866857 20:10210610-10210632 ATTACTTTTTGGGTTTCTGTTGG + Intergenic
1170000925 20:11612479-11612501 TTTATGTTTTTGTTTTGTTTGGG - Intergenic
1170577697 20:17676724-17676746 TCTAGATTTTTGGGTTCTCTGGG - Intronic
1170964132 20:21051385-21051407 TTTGGGTTTTTGGTCTATTTTGG + Intergenic
1171545429 20:25997197-25997219 TTTTGGTTTTTGTTTTATGGTGG + Intergenic
1173087014 20:39931798-39931820 TTTAGTTTTTTACTTTCTGTGGG - Intergenic
1173492585 20:43495104-43495126 TTTAATTTTTTGTTTCCTGTGGG + Intergenic
1173495953 20:43517679-43517701 TTTATGTTGATGGTTTCTCTTGG + Intronic
1173632015 20:44523600-44523622 TTTAGGATTTGGGTTTATGCTGG + Intergenic
1174257386 20:49267547-49267569 TTTGGGGTTTTGTTTTCTTTTGG + Intronic
1174273035 20:49383479-49383501 TTTACGTTTTTGGGTTTTTTTGG - Intronic
1174890707 20:54388886-54388908 TTTTGTTTTTTGGTTTTTTTGGG - Intergenic
1175596929 20:60242712-60242734 TTTGGGTTTTTGGATTTTTTGGG - Intergenic
1176859589 21:14001508-14001530 TAAAGGCTTTTGTTTTCTGTTGG + Intergenic
1177083266 21:16668876-16668898 GTTAGGTTTTAGTTTTCTTTGGG - Intergenic
1177193432 21:17877126-17877148 TTTAGGTCTTTAATTTCTCTTGG - Intergenic
1177247078 21:18540876-18540898 TTTAGTATTTTGTTTACTGTGGG + Intergenic
1177392955 21:20499850-20499872 TTTAGGATTTTGATTGCTTTGGG + Intergenic
1177456529 21:21346197-21346219 TTTTTTTTTTTGGTTTCAGTTGG - Intronic
1177566875 21:22834893-22834915 TTTTTTTTTTTGGTTTCTGTTGG - Intergenic
1178988376 21:37329822-37329844 TTTTAGCTTTTGGTTGCTGTTGG - Intergenic
1179280280 21:39928040-39928062 TTTTAGTTTTTTATTTCTGTAGG + Intronic
1180312505 22:11251686-11251708 TTTGGGTTTTTGGGTTCCGAGGG - Intergenic
1181263681 22:21617261-21617283 TTTTGTTTTTTGTTTTTTGTTGG + Intronic
1182567106 22:31208299-31208321 CTTAGGTTTTTGTTTTCGATGGG + Intergenic
1183024239 22:35052197-35052219 TTTATCTTTTTGGTTTATTTGGG - Intergenic
1183449502 22:37884309-37884331 TTGGGGTTTTTGGTTTTTGGGGG + Intronic
1183621233 22:38973987-38974009 TTTTGGTTTTTGGTTTGGTTTGG + Intronic
1183774726 22:39956460-39956482 TTTAAGTTTTGGGTTTTTTTGGG + Intronic
1183847978 22:40558762-40558784 TTTTGGTTTTTGTTTTTTTTGGG + Intronic
1184546267 22:45170681-45170703 TTTTGGTTTTTTGTTGTTGTTGG + Intronic
1184725665 22:46344023-46344045 TTTTGATTTTTTGTTTTTGTAGG - Intronic
1203244715 22_KI270733v1_random:55013-55035 TTTTGATTTTTGGTTTTTCTGGG + Intergenic
949281777 3:2354525-2354547 TTCAGGTTTTTCTTTTCTGATGG - Intronic
949439592 3:4066259-4066281 CTCATGTTTTGGGTTTCTGTTGG - Intronic
949465041 3:4335394-4335416 TTTTGGTATTTGGTAGCTGTAGG - Intronic
949957641 3:9282488-9282510 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
950239912 3:11359704-11359726 TTTTGTTTTTTTGTTTCTTTGGG - Intronic
951018728 3:17758683-17758705 TTTTCCTTTTTGTTTTCTGTGGG - Intronic
951106589 3:18751152-18751174 TTTAGGTTTTTTTTTTTTGGTGG + Intergenic
951271306 3:20628106-20628128 TTTGTTTTTTTGGTTTCTGTTGG + Intergenic
951508071 3:23471327-23471349 TTGAGGTTGTTGCTATCTGTAGG - Intronic
951788290 3:26449320-26449342 TTTGGGTTTGTGTTTTCTCTGGG + Intergenic
951835482 3:26978476-26978498 TTTATGTTTTTTGTTTATTTAGG - Intergenic
952034397 3:29181857-29181879 CTGAGGTTTTTGCTTTCTTTTGG + Intergenic
952049431 3:29365245-29365267 TTTATGTTATTGCTTTCTGAAGG - Intronic
952121597 3:30251270-30251292 TTGAGGTTTGTGATTTCTGGCGG + Intergenic
952410289 3:33042863-33042885 TTTAGGTGCTTGGTGGCTGTAGG - Intronic
952499568 3:33947843-33947865 TTTTAGTTTTTGGTTTCTGAAGG + Intergenic
952604109 3:35123553-35123575 GTTAGGGTTTTGGTTTAGGTTGG - Intergenic
952768801 3:36978346-36978368 TTTAGGTTTTTTTTTTTTTTCGG - Intergenic
952824347 3:37512672-37512694 TTTAAATTTTTGGCTTCTTTTGG + Intronic
953761446 3:45690213-45690235 TTAAGGGTTTTGGTTTGTCTTGG + Intronic
953993396 3:47501177-47501199 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
954470809 3:50693375-50693397 TTTAGGTCTTTAATTTCTTTTGG + Intronic
954482564 3:50814750-50814772 TTTTAGTTTTTTGTTTCTGCTGG + Intronic
955136657 3:56225623-56225645 TTTAGGATTTCGGTTTGGGTTGG - Intronic
955362658 3:58289022-58289044 TTTTGATTTTTGTTTTTTGTTGG + Intronic
955425846 3:58788884-58788906 TTGAGGATTTTGGTATATGTGGG - Intronic
955470040 3:59277087-59277109 TTTGAGTTTTAGGTTTCTGTGGG + Intergenic
955512234 3:59692859-59692881 TTTAGGTCTCTGGTTAATGTGGG + Intergenic
955608433 3:60731730-60731752 TTTAGGTTTCTTCTGTCTGTTGG + Intronic
955692229 3:61602160-61602182 TTTAAATTTTTAATTTCTGTGGG + Intronic
956063024 3:65367755-65367777 TTTTAGTTTTTGGTTTACGTAGG + Intronic
956157962 3:66318089-66318111 TTTAGCTCTTGGGGTTCTGTGGG + Intronic
956295957 3:67713876-67713898 TTTGTGTTCTTGGTATCTGTTGG - Intergenic
956809508 3:72850664-72850686 TTGTTGTTTTGGGTTTCTGTTGG + Intronic
956863620 3:73348438-73348460 TTGGGATTTTTGGTTTCTTTGGG + Intergenic
957163405 3:76639741-76639763 TTTAGCCCTATGGTTTCTGTTGG - Intronic
957204316 3:77175327-77175349 TTTGGGTTTTTGGGTTTTTTCGG + Intronic
957440247 3:80237047-80237069 TTTAGGTTTCTGCTTACTGCTGG - Intergenic
957808162 3:85179433-85179455 TTTTGGTTTTTGCTTTTTTTTGG + Intronic
958492719 3:94797838-94797860 TTTAGGTTTTTTCTATCTATTGG + Intergenic
958926626 3:100164844-100164866 TTGAGGTTGTTTGTGTCTGTAGG + Intronic
959795042 3:110416546-110416568 TTGAGGTCTTTGGATTCTTTGGG - Intergenic
959927718 3:111942597-111942619 TTTACGTTTTTGTTTTTTGTTGG + Intronic
960093659 3:113667144-113667166 TTTACGTATTGGGTCTCTGTTGG - Intronic
960561745 3:119091974-119091996 TTTTGGTTTTTGGTTTTTTTGGG + Intronic
960647879 3:119909329-119909351 TTTTGGTTTTCTGTTACTGTGGG + Intronic
960655450 3:119998839-119998861 TTTATGTTTTTCAGTTCTGTAGG - Intronic
960843556 3:121985968-121985990 TTTAGTTGCTTGGTTTATGTAGG + Intergenic
960860174 3:122143829-122143851 TTATGGGTCTTGGTTTCTGTTGG - Intergenic
961690848 3:128668478-128668500 TTTAGTTTTTTGTTTTTTGTGGG + Intronic
961948318 3:130717876-130717898 TTTAGGTCTTTGGTTTGTACAGG - Intronic
962121442 3:132564989-132565011 TTTATGTTTTTGTTTTGTTTTGG - Intronic
962291876 3:134144389-134144411 TTTAGGTTTTTTCTGTCAGTAGG + Intronic
962353052 3:134669682-134669704 TTTAGCTCCATGGTTTCTGTAGG + Intronic
962363711 3:134762838-134762860 TTGTTGTTTTTTGTTTCTGTGGG - Intronic
962418314 3:135204009-135204031 TTTTGATTTTTAGTTTTTGTAGG + Intronic
962530399 3:136275338-136275360 TTTAAGTTTTTTTTTTATGTTGG + Intronic
962603785 3:137014957-137014979 TTTTGTTTTTTTGTTTTTGTGGG - Intergenic
963404169 3:144841129-144841151 ATTTGGTTTTGGTTTTCTGTAGG + Intergenic
963495106 3:146048557-146048579 TTGTGGATTTTGGTATCTGTGGG + Intergenic
963664144 3:148160932-148160954 ATTAGGTTGTTGGTTGCTGAAGG - Intergenic
964072611 3:152653133-152653155 TTTAGGTTCTTGAATTCTGGTGG - Intergenic
964210967 3:154227620-154227642 TTTATGTTTTTGTGTTTTGTTGG + Intronic
964239836 3:154578966-154578988 TTCAGGTTTTGGATTTCTTTTGG - Intergenic
964629771 3:158797898-158797920 TTTACCTTTTTTTTTTCTGTAGG + Intronic
965096036 3:164227154-164227176 TTTAAGTTTCTGGTCTCAGTAGG + Intergenic
965339700 3:167473512-167473534 TTTATGTATTTGGTTTATATTGG + Intronic
965668753 3:171124275-171124297 TTTTGGTTTTTGGTTTTAGTAGG - Intronic
965750227 3:171968315-171968337 TTTTGGTGTTGGGATTCTGTTGG - Intergenic
965824349 3:172715851-172715873 TTTTGCTTTTTGGTTTTTTTTGG + Intergenic
965945435 3:174234589-174234611 TTTAGGTTTTTTCTATCTATTGG + Intronic
965951884 3:174318874-174318896 TTTTGTTTTTTGATTGCTGTAGG - Intergenic
966715478 3:183009824-183009846 TAGTGGTTTTTTGTTTCTGTGGG + Intergenic
967060710 3:185870094-185870116 ATTATGTTTGTGGATTCTGTGGG - Intergenic
967223789 3:187272290-187272312 GTTAGGTTTTCTGTTTCTTTAGG + Intronic
967415870 3:189217943-189217965 TTTTGTTTTGTGGTTGCTGTTGG - Intronic
967504709 3:190240208-190240230 TTTTTGTTTTTGTTTTTTGTTGG - Intergenic
967774098 3:193368303-193368325 TTTAGGTCTTTACTTTCTCTTGG - Intronic
968502308 4:956420-956442 GTCACGTTTTTGGTTTTTGTGGG + Intronic
968782526 4:2593892-2593914 TTTAGGCTTTTGGGATTTGTTGG + Intronic
968911398 4:3478539-3478561 TGCAGGTTTGTGGGTTCTGTGGG - Intronic
969080389 4:4613280-4613302 TTTGGGGTTTTCATTTCTGTGGG - Intergenic
969893825 4:10284359-10284381 TTTAGGTCTTCGCTTTATGTAGG - Intergenic
970045763 4:11851433-11851455 TTTCTGTTTGTGGTTTTTGTTGG - Intergenic
970471130 4:16380350-16380372 TTTAGGTTTTTTCTATCTATAGG + Intergenic
970562724 4:17298818-17298840 TTGAGTTTTTTGTTTTTTGTTGG - Intergenic
970691725 4:18628680-18628702 TGTAGGTGTTTGGTCTATGTTGG - Intergenic
970809572 4:20076293-20076315 TTTGGGTCTTTGGGTTATGTGGG + Intergenic
970913687 4:21308170-21308192 TTTAGGTTTCCTCTTTCTGTTGG - Intronic
971192137 4:24437816-24437838 TCTAGTTTTTTTGTTTCTTTTGG + Intergenic
971830518 4:31686370-31686392 TTCAGGTTGCTGGTTTCTGGGGG + Intergenic
971892723 4:32545077-32545099 TTAAGGTTTTGGGTGACTGTTGG + Intergenic
972216384 4:36901562-36901584 TTTAGGTCTTTGACTTCTCTAGG - Intergenic
972227569 4:37031335-37031357 TTTAGATTTTGGGTTTTAGTAGG - Intergenic
972579700 4:40384512-40384534 TTTAATTTTTTTATTTCTGTGGG - Intergenic
972833181 4:42837330-42837352 TTTAGGATTTTGGGTGCTTTGGG - Intergenic
972873270 4:43327033-43327055 TATAAGCTTTTGGCTTCTGTGGG - Intergenic
973272479 4:48275801-48275823 TCTAGGTGTCTGGTTTCTTTTGG - Intergenic
973537987 4:51904072-51904094 TTTAGGTATTTGGTTGCTGTGGG + Intronic
973682598 4:53336254-53336276 TTTCTGTTTTTGTTTTCTGTGGG - Intronic
974181114 4:58386056-58386078 TTTCAGTTTCAGGTTTCTGTGGG + Intergenic
974294438 4:59978653-59978675 TTTAGGTTTTTAAATTCTGTTGG + Intergenic
974388805 4:61237322-61237344 TTTTGGTCCTGGGTTTCTGTTGG + Intronic
974899626 4:67981581-67981603 TTTGGGTTTTGGGTTTTTTTTGG + Intergenic
975159440 4:71109149-71109171 TTTTGTTTTTTGATTGCTGTAGG + Intergenic
975212986 4:71722609-71722631 CTTAGCTTTTTGGGCTCTGTGGG + Intergenic
975888807 4:78999319-78999341 TTTAGCTTTGTAGTATCTGTAGG + Intergenic
975950924 4:79769986-79770008 TTGTGGTTTTTGTTTTCTGGTGG - Intergenic
976089193 4:81438198-81438220 TTTGTTTTTTTTGTTTCTGTAGG - Intronic
976119313 4:81762384-81762406 TTTGGGTTTTTTATTTTTGTAGG - Intronic
976237107 4:82909827-82909849 TTTGGTTTTTTGTTTTCTGATGG + Intronic
976401347 4:84610421-84610443 TTTTGGATTTTGGTGTGTGTGGG + Intronic
976579966 4:86724707-86724729 TTTAGGATTTTTTTTTCTTTTGG + Intronic
976795485 4:88927481-88927503 TCTAGGTTTTTTTTTTCTCTTGG + Intronic
976839501 4:89414743-89414765 TTTAGGTTCTTGGGAACTGTAGG + Intergenic
977061690 4:92266247-92266269 TTTAAATTTTTAGTTTATGTTGG + Intergenic
977226226 4:94395086-94395108 TTTCTGATTTTGGTTTCAGTTGG + Intergenic
977732748 4:100373818-100373840 TTTAGGTTTGTGATTGCTCTTGG - Intergenic
977773412 4:100887361-100887383 TTTTGTTTTTTGTTTTCTGGTGG + Intergenic
977829117 4:101569461-101569483 TTTAAGTCTTTGGTTTATCTTGG - Intronic
977873290 4:102119504-102119526 TTCAGGTTTTGGATTTCTATAGG + Intergenic
978432440 4:108647095-108647117 TTTAGATTTATTATTTCTGTAGG + Intergenic
978475315 4:109121779-109121801 TATAAGTTTTTGGTTCCTTTCGG - Intronic
978969121 4:114780927-114780949 ATTTGGTTTTGGTTTTCTGTGGG + Intergenic
979143155 4:117203847-117203869 TTTAAGTATTTAGTTTCTGTGGG - Intergenic
979178372 4:117692919-117692941 TTTTGTTTTTTTGTTTTTGTAGG - Intergenic
979745561 4:124208614-124208636 CTGAGGTATTTGGTTTCTCTTGG - Intergenic
980151356 4:129052539-129052561 TGGTAGTTTTTGGTTTCTGTGGG + Intronic
980216660 4:129860638-129860660 TTTAGTTTTTTGTTTTGTTTTGG + Intergenic
980576068 4:134684426-134684448 GTTACGTTATTGGTTTGTGTAGG + Intergenic
981111691 4:140942164-140942186 TTTTGTTTTTTGGTTTTTTTTGG - Intronic
981336488 4:143574140-143574162 ACTAAGTTTTTGTTTTCTGTAGG + Intergenic
982160498 4:152564073-152564095 TGTGGGTTGTTGGTTTTTGTGGG - Intergenic
982329569 4:154166033-154166055 ATATGGTTTTTGGTTTTTGTTGG - Intergenic
982745378 4:159100956-159100978 TTTTTGTTTTTTGTTTTTGTGGG + Intergenic
982903305 4:161035663-161035685 TCTTGGTTTTGGTTTTCTGTGGG - Intergenic
982932918 4:161430733-161430755 TTTTTGTTTTTGTTTTCTGACGG - Intronic
983063210 4:163181167-163181189 TGTAGGTCTTTTGTTTCTGGAGG - Intergenic
983077916 4:163348288-163348310 TGTTGGTTTGTGTTTTCTGTAGG + Intronic
983165722 4:164475055-164475077 TTTTTTTTTTTGGTTTCTATTGG + Intergenic
983372350 4:166877219-166877241 TTCAGAATTTTGGTTTCTATAGG - Intronic
983516105 4:168658245-168658267 TATAGGTTTTGGTTTTTTGTTGG + Intronic
983822576 4:172213932-172213954 TTTAGGTGTTTGATTTATTTTGG + Intronic
983984467 4:174041540-174041562 TTCAGAATTTTGGTTTCTTTTGG - Intergenic
984009980 4:174358992-174359014 CTTTGGTTTTTGGTTTCAGTTGG + Intergenic
984560248 4:181259631-181259653 TTTAGGTTAGAGTTTTCTGTTGG - Intergenic
984754897 4:183315807-183315829 TTTTGGTGTTTGGTTTTTTTTGG + Exonic
985375724 4:189335620-189335642 ATTTTGTTTTTGGTTTCTTTTGG + Intergenic
985919066 5:2953627-2953649 TTTAGGTTTTCTGTTTCTTCTGG + Intergenic
986656798 5:10020901-10020923 TTTGGTTTTTGGTTTTCTGTCGG - Intergenic
986675018 5:10176541-10176563 TTTATGTTTTTAATTTTTGTGGG - Intergenic
986918449 5:12655734-12655756 TTTTGTTTTTTGATTTCTATTGG - Intergenic
987891956 5:23890584-23890606 TTTTGTTTTTTGTTTTTTGTGGG - Intergenic
988280198 5:29135275-29135297 ATTTGGTTTTGGTTTTCTGTCGG + Intergenic
988737665 5:34038961-34038983 TTCAGGTTTTTGCTATCTTTAGG - Intronic
988912689 5:35860649-35860671 TTTTGTTTTTTGTTTTTTGTTGG + Intronic
989434498 5:41395752-41395774 TTCAGGTTTTGGATTTCTTTTGG - Intronic
989701482 5:44270657-44270679 TTTTAATTTTTAGTTTCTGTAGG - Intergenic
990328722 5:54704093-54704115 TGAAGGCTTTTGGTTTCTGTTGG + Intergenic
990828479 5:59929537-59929559 TTTAGCTTTTTGGATTCTTTGGG - Intronic
990865711 5:60377621-60377643 TCTTGGCTCTTGGTTTCTGTAGG - Intronic
990998490 5:61757832-61757854 TTTTGGTTTGGGGTTTCTCTTGG + Intergenic
991083418 5:62625244-62625266 TTCAAGATTTTAGTTTCTGTGGG - Intronic
991561545 5:67958744-67958766 TTTGGGTTTTGTTTTTCTGTAGG - Intergenic
991904203 5:71492166-71492188 TTTAGGTTGTTTTTGTCTGTTGG + Intronic
992038887 5:72808950-72808972 ATTAGCTTTCTGGGTTCTGTGGG + Intergenic
992160505 5:73996257-73996279 CTGAGGATTTTGGTTTCTTTGGG - Intergenic
992508828 5:77413745-77413767 TTTATGTTTGTGTTTTGTGTAGG + Intronic
992534637 5:77686908-77686930 TTTCGTTTTGTGCTTTCTGTTGG - Intergenic
992821228 5:80498458-80498480 TTAAGGTTTTTGGTTTTTTGGGG + Intronic
992855739 5:80859731-80859753 TTTTGTTTTTTGGTTTCTTGGGG + Intronic
993121773 5:83783670-83783692 TTTAGGTTTTTAATATCTGTTGG - Intergenic
993183620 5:84587234-84587256 TTTAGGTATTTAGTTTTGGTTGG + Intergenic
993797680 5:92288127-92288149 TTTTAGTTTTTAGTTTCTTTTGG + Intergenic
994747123 5:103692127-103692149 TTTAGTTTTTTCTTTTCTATTGG + Intergenic
994944270 5:106365092-106365114 TTTAGGTATTAGGTTTATTTAGG + Intergenic
994968588 5:106706197-106706219 ACTAGGTTTTTGGTTTTTTTTGG + Intergenic
994976925 5:106819792-106819814 TTTAAGTTTTTGGCTTCCTTAGG + Intergenic
995530904 5:113091144-113091166 TCTGGGGTTTTGGTTTCTGAAGG - Intronic
995876451 5:116795218-116795240 TTTAGGTTTTTAGGTTTTTTTGG - Intergenic
996811825 5:127524279-127524301 TTTTGCTTTTTGGTTTGTTTTGG - Intronic
996906224 5:128603883-128603905 TTTTCTTTTTTGGTTTCTGTTGG + Intronic
997183405 5:131857423-131857445 TTTAGCTTTTGGGTAACTGTAGG + Intronic
997391026 5:133516414-133516436 TTTATATTTTTGGTTGCTTTTGG - Intronic
997643451 5:135464969-135464991 ATTAGACTTTTAGTTTCTGTAGG + Intergenic
998052971 5:139051721-139051743 TGTAGGTTTTCAGTTTCTCTTGG - Intronic
998359761 5:141574801-141574823 TACTGGTTTTTGGTTTGTGTTGG - Intronic
999487825 5:152016964-152016986 TCTAGGGTTTTAGTTTCGGTGGG + Intergenic
999689479 5:154134385-154134407 TTTTGGTTTTTGGTTTTTTGGGG + Intronic
999747770 5:154605352-154605374 GCTAGGTTTTTTGTTACTGTAGG - Intergenic
1000026760 5:157365512-157365534 TTCTGGTTTTTGGTTTTTATAGG + Intronic
1000154405 5:158536491-158536513 TTTAGGTGTTTGTTGTCTGGAGG + Intergenic
1000457481 5:161469508-161469530 TTTTGTTTTTTGGTTTTTTTTGG - Intronic
1000590030 5:163146949-163146971 CTTAGCTTGTTGGTTTCTGTTGG - Intergenic
1000692362 5:164339341-164339363 TTTAGCTTTTTGTATTCTTTTGG + Intergenic
1000749643 5:165078030-165078052 TTTGGGTTATTGCTGTCTGTGGG + Intergenic
1000871157 5:166579094-166579116 CTGAGGATTTTGGTATCTGTGGG - Intergenic
1000925084 5:167184450-167184472 TTTTTGTTTTTGTTTTTTGTTGG + Intergenic
1001733982 5:173983717-173983739 TATTGGTTTTAGTTTTCTGTGGG - Intronic
1001755600 5:174166219-174166241 TTTTGCTTTTTGGTTTTTGGAGG - Intronic
1002812864 6:650765-650787 ATTAGATTTTTCATTTCTGTTGG + Intronic
1003237836 6:4313707-4313729 TATTTGTTTTTGGTTTTTGTGGG + Intergenic
1003261684 6:4522343-4522365 TTTAAGTTTTTAATTTCAGTTGG - Intergenic
1003544720 6:7050101-7050123 TTTTGTTTTTTGGTTTTTTTTGG - Intergenic
1003789322 6:9525186-9525208 TTTAGCTATTTATTTTCTGTTGG - Intergenic
1003834230 6:10050695-10050717 TGTATGATTTTGCTTTCTGTTGG - Intronic
1004155476 6:13163583-13163605 TATAGGTTTGTGTTTTCTATGGG + Intronic
1004200768 6:13545836-13545858 TTAGGTTTTTTGGTTTTTGTAGG + Intergenic
1004471162 6:15930689-15930711 ATTAAGTTTATGGATTCTGTGGG + Intergenic
1004526387 6:16412458-16412480 TTTTGTTGTTTGGTTTCTTTTGG - Intronic
1004704216 6:18108772-18108794 CTTATGTTTTTGTTTTTTGTTGG - Intergenic
1005047755 6:21658293-21658315 TTTAGTTTTTTTGTTTTTTTGGG - Intergenic
1005284401 6:24309542-24309564 TTTGGGATTTTGTTTTCAGTAGG - Intronic
1006628996 6:35417954-35417976 TCTAGTCATTTGGTTTCTGTTGG - Intronic
1007151742 6:39700005-39700027 TTTAGCTTTTTAATTTTTGTGGG + Intronic
1007184197 6:39953807-39953829 CATAGGTTTTATGTTTCTGTTGG - Intergenic
1007356247 6:41319810-41319832 TTTTTGTTTTTGTTTTTTGTGGG + Intergenic
1007640813 6:43338063-43338085 CTTCTGTTTTTGGTTTCTCTGGG + Exonic
1008219268 6:48835928-48835950 TTTAGGTTTTTTCTATCTATTGG + Intergenic
1008287030 6:49666164-49666186 TTTAGTTGTTTGTTTTCAGTAGG - Intergenic
1008645549 6:53510437-53510459 TTTTTTTTTTTGGTTTCTGTTGG - Intronic
1008647410 6:53529175-53529197 TTTAGGATTGTGTTTTCTCTTGG - Intronic
1008717007 6:54301050-54301072 TTTTAGTTTTCGGTTTCTTTGGG + Intergenic
1008858270 6:56117267-56117289 TGTTCTTTTTTGGTTTCTGTTGG - Intronic
1009738514 6:67711770-67711792 TTTTTTTTTTTGGTTTCTATTGG + Intergenic
1010118635 6:72346036-72346058 TTTAACTTTTTGTTTTCTGCAGG - Intronic
1010186284 6:73146949-73146971 TTTATGTCTTTGTTTTCTATTGG + Intronic
1010207638 6:73337284-73337306 TTTAAGTTGTTGATTTCTGATGG + Intergenic
1010228636 6:73515014-73515036 TTTAGTTTTGTGGGTTCTATGGG - Intergenic
1010375201 6:75160651-75160673 GTGAGGATTTTGGTTTCTATGGG - Intronic
1011207158 6:84912322-84912344 TTTAAATTTTTGGTTTCAGGAGG - Intergenic
1011331352 6:86210550-86210572 TTTTGGTTTTTTGTTTGTTTTGG - Intergenic
1011639565 6:89406377-89406399 CTTGGGTCTTGGGTTTCTGTAGG - Intronic
1012379775 6:98606325-98606347 TTTACGTTTTTTTTTTCTTTAGG + Intergenic
1012540244 6:100354338-100354360 TTTTGTTTTTTGGTTTTTGTGGG + Intergenic
1013018446 6:106183678-106183700 TTTAGAAATTTGGTTTATGTGGG - Intergenic
1013765316 6:113567332-113567354 TTTGTGCTTTGGGTTTCTGTTGG + Intergenic
1014275143 6:119379594-119379616 TTTAGGATTTTGTTTGGTGTAGG + Intergenic
1014406075 6:121052775-121052797 TTCAGAGTTTTGGTTCCTGTGGG - Intergenic
1014604174 6:123451478-123451500 TCTAGGTTTTTAGTTTATGTGGG - Intronic
1015225480 6:130852555-130852577 TTTAGGTTTTTGGCTTGGGCAGG - Intronic
1015264163 6:131273495-131273517 TTTACGTTAGTGGTTACTGTAGG + Intronic
1015461602 6:133497749-133497771 TTTAGGGATTTGGTTTATCTTGG + Intronic
1015694214 6:135962134-135962156 TTTAAGTCTTTGGTTTTTTTAGG - Intronic
1015697027 6:135991930-135991952 TGAAGGTTTTTGGTTTGTTTTGG + Intronic
1015804639 6:137096170-137096192 TTTTGGTTTTTGTTTTGTGGTGG - Intergenic
1015842375 6:137489063-137489085 TTTCGGAGTTTGATTTCTGTGGG + Intergenic
1015902016 6:138076959-138076981 TTTGGGTTTTTTTTTTGTGTGGG - Intergenic
1015948910 6:138531677-138531699 TTTTTGTTTTTTGTTTTTGTAGG + Intronic
1016116973 6:140299078-140299100 TTTGGGGTTTTGGTTAATGTGGG + Intergenic
1016274673 6:142335208-142335230 TTTAGATGTTTGGTTTTTGGTGG + Intronic
1017079986 6:150658846-150658868 GTTAGTTTTTTGCTTTCTGAAGG - Intronic
1017573085 6:155768974-155768996 GTTAGGTTTTATGTTTCTTTCGG + Intergenic
1018129661 6:160716921-160716943 TTATGGTTATTGGTTACTGTGGG + Intronic
1018845897 6:167555239-167555261 TTCAGGTTTTTTCTATCTGTAGG + Intergenic
1018877278 6:167834101-167834123 TTTAAATTTTTTATTTCTGTAGG + Intronic
1019169322 6:170123090-170123112 TTTATTATTTTGTTTTCTGTGGG - Intergenic
1019464836 7:1181910-1181932 TTTTCCTTTTTGGATTCTGTAGG - Intergenic
1019655082 7:2188682-2188704 TTTAGGTCTTTGATTTGTTTTGG - Intronic
1019904832 7:4053897-4053919 TTTGGGTTTTTTGTTGTTGTTGG + Intronic
1019993182 7:4706625-4706647 TTTTGCTTTTTGGTGACTGTTGG - Intronic
1020222365 7:6249524-6249546 GTTTGGATTTTGGGTTCTGTTGG - Intronic
1020478539 7:8628432-8628454 TTTGGGTTTTTGGTTTAGTTTGG - Intronic
1020680894 7:11235148-11235170 TTCAGGTTTTTTCTGTCTGTTGG + Intergenic
1021470534 7:20997617-20997639 TTTGGGGTTTTGTGTTCTGTTGG - Intergenic
1021475977 7:21060925-21060947 TTAAGGTTTCTGTTTTCTTTTGG - Intergenic
1021498571 7:21303924-21303946 ATTAGGTTTCTGGTTTATTTAGG + Intergenic
1021520445 7:21534830-21534852 TTGTCTTTTTTGGTTTCTGTTGG + Intergenic
1021772189 7:24015894-24015916 TTTTGGGTTTTGGTTTGTTTGGG - Intergenic
1021967414 7:25934313-25934335 TTGTGTTTTTTGGTTTTTGTTGG - Intergenic
1022216400 7:28266665-28266687 ATTAGGCTTTTGGTTTATTTAGG + Intergenic
1022261180 7:28706390-28706412 TTTAGGATGTAGGTATCTGTGGG + Intronic
1023533094 7:41179696-41179718 TTGAGGTATTTGGTATCTGCGGG - Intergenic
1023550170 7:41361597-41361619 TTTTGCTTTTTATTTTCTGTAGG + Intergenic
1023945627 7:44800743-44800765 GTTGGGTTTTTTGTTTCTTTGGG + Intronic
1024120790 7:46236537-46236559 GTTAGGTTGTTGTTTTCTTTTGG - Intergenic
1024566384 7:50684630-50684652 CTTAGGTTTTTGGTTCTTGCTGG - Intronic
1024675951 7:51638104-51638126 TTCAGGCCTTTGGATTCTGTTGG + Intergenic
1025016434 7:55442651-55442673 TTTAGGTTTTTTTTTTTTTTTGG - Intronic
1026369379 7:69683587-69683609 TTTTGGTTTTGGGTTTTTGGGGG - Intronic
1027752662 7:82170322-82170344 TTTTGGTTTTTGTTTTTTTTTGG + Intronic
1028560300 7:92168030-92168052 TATTTGTTTTTGGCTTCTGTTGG - Intronic
1029046869 7:97639322-97639344 ATTAGGCTTGTGGGTTCTGTGGG - Intergenic
1030154925 7:106445139-106445161 TTTAAATTTTTAATTTCTGTGGG + Intergenic
1030459824 7:109819983-109820005 TTTGATTTTTTGCTTTCTGTGGG - Intergenic
1030491165 7:110236392-110236414 TTTAGGTCCTGGATTTCTGTTGG - Intergenic
1030903568 7:115154031-115154053 TTTAGCTGTTTGGTTTCTGCTGG + Intergenic
1030994773 7:116346609-116346631 TTTTGCTATTTGTTTTCTGTAGG + Intronic
1031536002 7:122933649-122933671 TTTATGTTTTTGGTTCTGGTAGG + Intergenic
1032066091 7:128772449-128772471 TTTAGTAGTTTGGTTTCTGACGG + Intergenic
1032358086 7:131228941-131228963 CTTGGGTTTTTGTTTTCTCTGGG - Intronic
1032372899 7:131377763-131377785 TTTAGGTATTTGAATACTGTAGG + Intronic
1032910528 7:136424090-136424112 TTTAGCTATATGCTTTCTGTAGG + Intergenic
1033310433 7:140257818-140257840 TTTAAATTTTTTGTTTCTATAGG - Intergenic
1033570317 7:142621417-142621439 TTTAGTATTTTGGTTTCTGTGGG - Intergenic
1033794080 7:144826660-144826682 TTTATTTTTTTTGTTGCTGTTGG - Intronic
1033969021 7:147014760-147014782 TTTATTTTTTTGTTTCCTGTTGG - Intronic
1034004561 7:147455688-147455710 TTTTTGTTTTTGCTTTCTTTTGG - Intronic
1034073722 7:148212120-148212142 TTTTGGTTTCTGTTTTTTGTGGG + Intronic
1034278432 7:149834847-149834869 TTCATGTTTATTGTTTCTGTTGG + Intergenic
1034482848 7:151336279-151336301 TTGAGGATTTTGGTATCTGTAGG + Intergenic
1035198114 7:157240072-157240094 TTTTGGTTTTTGGTTTTTTGGGG + Intronic
1035319789 7:158021420-158021442 TTTAGGTATTTGGTTTTTGCCGG - Intronic
1035607062 8:936698-936720 TTTGGTTTTTTAGTTGCTGTTGG + Intergenic
1036411354 8:8505154-8505176 TTTAGAATTTTTGCTTCTGTAGG + Intergenic
1037223639 8:16555759-16555781 TTTAGTTTGTTGGTTTCTCAGGG + Intronic
1037311738 8:17563342-17563364 TTTAGGATTTAGCTTTCTTTGGG - Intronic
1037473433 8:19233341-19233363 ATTAGGTTTATGGTTAGTGTTGG + Intergenic
1037476521 8:19263206-19263228 TTTAAATTTTTTATTTCTGTAGG + Intergenic
1037523069 8:19698866-19698888 TCAAGGATTTTGGTATCTGTGGG - Intronic
1037840727 8:22243697-22243719 TTTTTGTTTTTGTTTTCTTTTGG - Intergenic
1038555933 8:28515744-28515766 TTCAGGTTTTTCTTATCTGTTGG + Intronic
1038919045 8:32061995-32062017 TTTAGAATTTTGCTTTCTCTTGG - Intronic
1039193114 8:34999479-34999501 TTTAGCTTTTTCTTTTCTGGTGG - Intergenic
1039350409 8:36757921-36757943 TTTAGTTTTTTTGTGTATGTGGG + Intergenic
1039937183 8:42055437-42055459 TTTTGCTTTTTGTTTTTTGTGGG + Intergenic
1040424901 8:47275844-47275866 TTTTTGTTTTTGTTTTTTGTTGG + Intronic
1040458112 8:47620606-47620628 TTTTGTTTTTTTGTTTCTTTGGG + Intronic
1041529433 8:58847378-58847400 TTTATATTTTTGGTTTCATTTGG - Intronic
1041838453 8:62243065-62243087 GTTAGGTTTTACGTTTCTGATGG + Intergenic
1041851792 8:62401606-62401628 TCTAAGTTTTTGGTTACTGCAGG + Intronic
1041902777 8:63000400-63000422 TTTATGAATTTGGTTTCTTTCGG - Intergenic
1042168172 8:65966606-65966628 TTTTGTTTTTTGGTTTTTATGGG - Intergenic
1042347559 8:67743304-67743326 TTTAAGTTTTTAATTTTTGTGGG + Intronic
1042430416 8:68700135-68700157 TTTGGGTTTTTGGTATTTGTCGG - Intronic
1042459041 8:69040939-69040961 ATTCGGTTTTTGGTTACAGTTGG + Intergenic
1042633640 8:70848827-70848849 TTGTGTTTTTTGGTTTTTGTTGG - Intergenic
1042744519 8:72093174-72093196 TTTTGGTTTTATTTTTCTGTTGG + Intronic
1042936468 8:74064137-74064159 TTTTGGTTTTTGTTTTATATTGG - Intergenic
1043092527 8:75924041-75924063 TTTAGCTTGTGAGTTTCTGTGGG - Intergenic
1043739438 8:83791795-83791817 TTTTTGTTGTTGCTTTCTGTTGG + Intergenic
1044128618 8:88491442-88491464 TTTTGGCTTTTGGCTTTTGTTGG - Intergenic
1044875989 8:96666856-96666878 TTTAGGTTTTCTGATTCTCTTGG + Intronic
1045548360 8:103148380-103148402 TTTTCATTTTTGATTTCTGTGGG + Intronic
1045613454 8:103876446-103876468 TTTAAATTTTTTGTTTCCGTAGG + Intronic
1045715173 8:105034936-105034958 TTTTGTTTTTTGTTTTTTGTTGG - Intronic
1045904093 8:107322368-107322390 TTTAGTTTCTTGGTTTCCTTGGG + Intronic
1046053264 8:109048578-109048600 TTGAGGTTTTTGGTTTTTTTGGG - Intergenic
1046178423 8:110610175-110610197 TTTGGGTTTTTGGATTTTTTTGG + Intergenic
1046928390 8:119817873-119817895 TTTTTGTTTTTGTTTTCTGGGGG + Intronic
1047291643 8:123536659-123536681 TGTAGGTTTTTGTTGTTTGTGGG - Intronic
1047312712 8:123706049-123706071 TTTAGCTGTTTGGTTTCAATTGG + Intronic
1048791758 8:138110746-138110768 TTTCGGTTTTTTGTTTTTTTTGG + Intergenic
1049827750 8:144680696-144680718 TTGAGTTTTTGGATTTCTGTGGG - Intergenic
1049874665 8:145008563-145008585 TTCAGGTTTTTTCTATCTGTTGG + Intergenic
1050089660 9:2004808-2004830 TTCTGCTTTTTGGTTTCTGTGGG - Intergenic
1050698912 9:8314615-8314637 TTTTGGGTTTTGGTTCCTTTTGG - Exonic
1050752218 9:8953090-8953112 TATATGCTTTTGGTTACTGTAGG + Intronic
1051301478 9:15655893-15655915 TTTCTGTTTTTGGTTTCTTGAGG - Intronic
1051769538 9:20561918-20561940 TTTGGGGTTTTGGTTTGTTTGGG + Intronic
1051857041 9:21580535-21580557 TTTAAGTGGTTGGTTTCTTTAGG - Intergenic
1052016023 9:23468647-23468669 TTTAGGTCTTTTCTTTCTCTTGG - Intergenic
1052099458 9:24427067-24427089 TTTAAATTTTTAATTTCTGTTGG + Intergenic
1052201757 9:25790690-25790712 TTTTGGTTTTTGTATTCTCTGGG + Intergenic
1052705671 9:31990625-31990647 TTGATGTTTTTCCTTTCTGTTGG - Intergenic
1053000126 9:34573389-34573411 TTCAGGGTTTGGGTTGCTGTGGG + Intronic
1053176827 9:35931833-35931855 TGTGCGTTTTTGTTTTCTGTGGG + Intergenic
1053478452 9:38398777-38398799 TTTCTGTTTTTGTTTTCTCTTGG + Intergenic
1053674212 9:40405903-40405925 TTTAGGTTTTTTGTTTCAATTGG + Intergenic
1053924015 9:43032272-43032294 TTTAGGTTTTTTGTTTCAATTGG + Intergenic
1054385319 9:64545971-64545993 TTTAGGTTTTTTGTTTCAATTGG + Intergenic
1054510409 9:65970387-65970409 TTTAGGTTTTTTGTTTCAATTGG - Intergenic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1054970031 9:71075124-71075146 TTTAGGTTTTTGTTTCTGGTTGG + Intronic
1055001193 9:71450816-71450838 TCATGCTTTTTGGTTTCTGTGGG - Intergenic
1055202637 9:73685041-73685063 ATTTGGTTTTGGTTTTCTGTGGG + Intergenic
1055227597 9:74017945-74017967 TTTATTTTTTTGTTTTCCGTTGG - Intergenic
1055740426 9:79382473-79382495 TTTAGGAATTTGGTCTTTGTGGG - Intergenic
1056177344 9:84048481-84048503 TTTTGGTTTTTTGTTTTTGGTGG - Intergenic
1056266289 9:84899827-84899849 TCCAGGTCTTTGGGTTCTGTGGG - Intronic
1056571027 9:87814776-87814798 TTTAGTTTTTTAATTTTTGTGGG + Intergenic
1056689712 9:88797465-88797487 TTTGGGTTTTTGCTATCTGTGGG + Intergenic
1057543189 9:95995395-95995417 TTTAGGTTTTAGGTTTATACTGG - Intronic
1057977491 9:99621714-99621736 TTGGCGTTTTTGGTCTCTGTGGG - Intergenic
1058083822 9:100727439-100727461 TTTTGTTTTTTGGTTTTTTTGGG - Intergenic
1058581366 9:106461855-106461877 ATTAGGTTTGAGATTTCTGTGGG - Intergenic
1058889620 9:109350000-109350022 TTTTGTTTTTTGGTTTTTTTTGG + Intergenic
1058990491 9:110251254-110251276 TAAAGGATTTTGGTTTCGGTGGG - Intronic
1059474784 9:114536893-114536915 TTTAAGTCTTTAGTTTCTCTTGG - Intergenic
1060592239 9:124824951-124824973 TTTTTGTTTTTGTTTTTTGTTGG + Intergenic
1060919899 9:127413185-127413207 TTTTTGTTTTTTGTTTCTTTTGG - Intergenic
1061341211 9:129983373-129983395 TTTAGCTTCTTGGTTTATGCTGG - Intronic
1061368119 9:130182985-130183007 TTGTGGTCTTTGGTGTCTGTGGG + Intronic
1062078880 9:134608219-134608241 TTTTGGTGTTTGCATTCTGTGGG + Intergenic
1203461046 Un_GL000220v1:38096-38118 TTTTGATTTTTGGTTTTTCTGGG + Intergenic
1185788648 X:2911697-2911719 TTTTTGTTTTTTGTTTCTTTTGG - Intronic
1185977967 X:4742566-4742588 TTTTTGTTTTTGTTTTCTTTTGG + Intergenic
1186847548 X:13545402-13545424 TTTATATTTTTGGCTTCAGTTGG + Intergenic
1186867084 X:13731452-13731474 TTTACATTTTTTGTTTCTGAAGG + Intronic
1187283297 X:17879451-17879473 TTGAGGTCTTTGGTGTCTGAAGG - Intergenic
1187538127 X:20162878-20162900 TCTAGGTTTTTGTTTTGTTTGGG - Intronic
1187613549 X:20968949-20968971 TTCAGGTTTTTGCTATCTATAGG - Intergenic
1187655910 X:21473718-21473740 TTTAGGTTTTTTGTTGTTGTTGG + Intronic
1187660702 X:21544210-21544232 TAGAGCTTTTTGGTTTCTTTTGG + Intronic
1187691711 X:21875288-21875310 TTCAGATTTCTGGTTTCTGTTGG + Intronic
1187896414 X:23984065-23984087 ATTAGGTGTTTGCTTTCTGAAGG - Exonic
1187949283 X:24456058-24456080 TTTTTGTTTTTGTTTTTTGTAGG + Intergenic
1188026800 X:25218447-25218469 TTGTGGATTTTGGTATCTGTAGG + Intergenic
1188610542 X:32090758-32090780 TTTGGGTTTTTTTTTTCTGCTGG + Intronic
1188725237 X:33574881-33574903 TTTGGATATTTGTTTTCTGTTGG + Intergenic
1188759555 X:34010224-34010246 TTTAAATTTTTAGTTTGTGTGGG + Intergenic
1188797731 X:34485873-34485895 CTAAGGCTTTTGTTTTCTGTCGG + Intergenic
1188898665 X:35700630-35700652 TTCAGGTTTTTCCTATCTGTTGG + Intergenic
1188998801 X:36919841-36919863 TTTAGCTTTTGGATTTCTTTGGG + Intergenic
1189419900 X:40847562-40847584 TTCAGGTTTTTCCTCTCTGTAGG - Intergenic
1190257612 X:48775189-48775211 TTTGGGTTTTTTGTTTTTTTTGG + Intergenic
1190373478 X:49765481-49765503 TATAGGTTTTATGTTTGTGTGGG - Intergenic
1190700136 X:52981582-52981604 TTTGTGTTCTTGGTTTCTGAGGG + Intronic
1192775139 X:74236743-74236765 TTTAGGGTTTTGTTTTGGGTTGG - Intergenic
1192882674 X:75303661-75303683 TTTAGTTATTTGTTTACTGTTGG + Exonic
1192960060 X:76120333-76120355 TTTATCTTTTTCTTTTCTGTTGG - Intergenic
1193071592 X:77311720-77311742 TTCATGCTTTTGGTTTCTGTTGG - Intergenic
1193102754 X:77634686-77634708 TTTAGGTGTTCAGTTTATGTGGG - Exonic
1193468259 X:81872123-81872145 TTTAGCTTTTTTTTTTCTTTTGG - Intergenic
1194005808 X:88490501-88490523 TTTAGCTTTAAGATTTCTGTTGG + Intergenic
1194615534 X:96098087-96098109 TATATGCTTTTGGTTTGTGTTGG - Intergenic
1194649081 X:96493520-96493542 TTTAGCTTTTTCATTTCTGAAGG - Intergenic
1194843962 X:98780267-98780289 GTTATTTTTTTGGTTTATGTGGG + Intergenic
1195255962 X:103091545-103091567 CTTGGATTTTTGGTATCTGTGGG + Intronic
1195309557 X:103618057-103618079 TTTTACTTTTTGTTTTCTGTAGG - Intronic
1195403318 X:104485162-104485184 ATTAGGTTTTTAGTCTCTTTGGG - Intergenic
1195906458 X:109849163-109849185 TTTAGGTTTTTGGGCAATGTAGG + Intergenic
1195916212 X:109938604-109938626 TTTATTATTTTAGTTTCTGTGGG - Intergenic
1196208003 X:112962981-112963003 TTTTGTTTTTTGTTTTCAGTGGG - Intergenic
1196574496 X:117302363-117302385 TTTAGCTTTTAGGTGACTGTTGG - Intergenic
1198156255 X:133963734-133963756 ATTAAGTTATAGGTTTCTGTGGG + Intronic
1199006520 X:142704869-142704891 TTTAATTTTTTAGTTTCTGTGGG - Intergenic
1199191663 X:144979010-144979032 TTTTAGTTTTTAATTTCTGTGGG - Intergenic
1199565295 X:149209198-149209220 TTTAGGTTTTTGGTCTTCCTAGG + Intergenic
1200909574 Y:8517810-8517832 TTAAGGTTTTTTTTTTCTGAAGG - Intergenic
1201359377 Y:13129781-13129803 TTTTGATTTTTGGTTTGTTTTGG - Intergenic
1201754232 Y:17469038-17469060 TTTAGGTTTTGGGTAGGTGTAGG + Intergenic
1201847320 Y:18436947-18436969 TTTAGGTTTTGGGTAGGTGTAGG - Intergenic
1201852722 Y:18504981-18505003 TTTATGTTTTTGTTTTCACTAGG + Intergenic
1201880599 Y:18815403-18815425 TTTATGTTTTTGTTTTCACTAGG - Intronic