ID: 911181352

View in Genome Browser
Species Human (GRCh38)
Location 1:94863268-94863290
Sequence TAGGGAAGCTGAGGCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 630}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911181349_911181352 -5 Left 911181349 1:94863250-94863272 CCAGGATGTGTTACAGACTAGGG No data
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181342_911181352 23 Left 911181342 1:94863222-94863244 CCAAGCCAGGCAGAGCCTCCAGC No data
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181345_911181352 8 Left 911181345 1:94863237-94863259 CCTCCAGCCATAACCAGGATGTG 0: 1
1: 0
2: 3
3: 18
4: 151
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181341_911181352 27 Left 911181341 1:94863218-94863240 CCAGCCAAGCCAGGCAGAGCCTC No data
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181347_911181352 1 Left 911181347 1:94863244-94863266 CCATAACCAGGATGTGTTACAGA 0: 1
1: 0
2: 0
3: 12
4: 114
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181346_911181352 5 Left 911181346 1:94863240-94863262 CCAGCCATAACCAGGATGTGTTA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630
911181343_911181352 18 Left 911181343 1:94863227-94863249 CCAGGCAGAGCCTCCAGCCATAA No data
Right 911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG 0: 1
1: 0
2: 6
3: 62
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911181352 Original CRISPR TAGGGAAGCTGAGGCAGTGC AGG Intronic
900789251 1:4668543-4668565 TGGGTAAACTGAGGCAGAGCAGG + Intronic
901019506 1:6248767-6248789 TGGGGAAACTGAGGCAGGACAGG + Exonic
901049854 1:6420599-6420621 TAGAGAAGCAGAGGCAGCCCTGG + Intronic
901107443 1:6768049-6768071 TAGGAAAGTTGGAGCAGTGCTGG - Intergenic
901338312 1:8471056-8471078 TTGGGAGGCTGAGGCAGGGGGGG - Intronic
901375086 1:8832296-8832318 TTGGGAAGCTGAGGCAGGGAGGG + Intergenic
901472798 1:9469296-9469318 TCGGGAGGCTGAGGCAGGGGAGG + Intergenic
901617287 1:10551863-10551885 TAGGGAGGCTGAGGCAGGTGTGG + Intronic
901691594 1:10976912-10976934 TTGGGATGCTGAGGCAGCGGGGG + Intronic
902416909 1:16245251-16245273 TGGGGAAGGGGAGACAGTGCAGG - Intergenic
902606742 1:17573307-17573329 TGGGGAAGCTGAGGCTCTGATGG + Intronic
902799356 1:18819729-18819751 TAGGGAAACTGAGGCTCTGAGGG + Intergenic
903258108 1:22116152-22116174 TAGTGAAGAAGTGGCAGTGCTGG + Intergenic
903390813 1:22962581-22962603 TAGGGAAGCTGAGACAGGAGAGG - Intronic
903801033 1:25968349-25968371 TTGGGAGTCTGAGGAAGTGCTGG + Intronic
904365375 1:30007799-30007821 CACTGAAGGTGAGGCAGTGCTGG - Intergenic
904602438 1:31680964-31680986 TAGGGGTGCCGAGGCAGGGCCGG + Intronic
904821980 1:33251457-33251479 TAGGGAAGCGGTGGGGGTGCTGG - Intergenic
905463299 1:38135081-38135103 TAGGGAGGCTGAGGCAGAAAGGG + Intergenic
905550543 1:38834626-38834648 TTGGGAAGCTGAGGCAGTGGAGG + Intergenic
906001815 1:42432895-42432917 AAGAGAGTCTGAGGCAGTGCTGG - Intronic
906353059 1:45080106-45080128 TGGGGTAGCTGAGGGAGTGATGG - Intronic
907273261 1:53303157-53303179 TAGGAAAGCTGGAGCAGTGGGGG - Intronic
907974829 1:59421582-59421604 AAGAGAAGCTGGGGCAGTGGGGG - Intronic
908104984 1:60832118-60832140 TTGGGCAGCTGAGGCGGTGCTGG - Intergenic
908392775 1:63698697-63698719 TGGGGCAGTAGAGGCAGTGCTGG + Intergenic
908475538 1:64484180-64484202 AAGGGAATCTGAAGCAGTGATGG + Intronic
909012302 1:70348370-70348392 TCGGGAGGCTGAGGCAGGACTGG - Intronic
909182372 1:72440260-72440282 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
909541973 1:76801628-76801650 GAGGGAAGGTGAGGCATTGCTGG - Intergenic
909650661 1:77972501-77972523 TTGGGAGGCCGAGGCAGGGCGGG + Intronic
910155930 1:84219450-84219472 TTGGGAGGCTGAGGCAGGTCAGG - Intronic
910331952 1:86083563-86083585 TTGGGAAGCTGAGGCAAAGGTGG + Intronic
910915075 1:92279627-92279649 AGGGCAAGCTGAGGCAGGGCGGG + Intronic
911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG + Intronic
911373594 1:97024144-97024166 TGGGGCAGCTAAGGGAGTGCAGG + Intergenic
911496437 1:98637480-98637502 TGGGGAAGCCAAGGGAGTGCTGG + Intergenic
912868024 1:113276639-113276661 TGGGGAAGCTGGGGGAGTGTGGG - Intergenic
913987136 1:143575352-143575374 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
914240627 1:145850405-145850427 TGGGGAGGGTGTGGCAGTGCAGG + Intronic
914338618 1:146739326-146739348 TAGGGAACCGGAGCCACTGCTGG + Intergenic
915190307 1:154144860-154144882 TTGGGAGGCTGAGGCAGGGTAGG + Intronic
915309369 1:154999656-154999678 GAGGGAAGCGGAGGCAGCGGAGG + Intergenic
915839220 1:159201790-159201812 GGGGGAAGCAGAGGCAGTTCAGG - Exonic
916206036 1:162317229-162317251 TGGGGGAGATGAGGTAGTGCAGG + Intronic
917226471 1:172788952-172788974 TGGGGCAGCTAAGGGAGTGCAGG - Intergenic
917774787 1:178321618-178321640 TAGGGAGGCTGAGGCAGGGGAGG - Intronic
917783979 1:178432611-178432633 TAGGAAAGAGGAGGCAATGCTGG - Intronic
918038874 1:180899998-180900020 AAGGGAAACAGAGCCAGTGCTGG - Intergenic
918756614 1:188345834-188345856 TGGGGAAGCCAAGGGAGTGCTGG - Intergenic
919767051 1:201134256-201134278 TACTGGAGCTGACGCAGTGCCGG + Intergenic
920184226 1:204150640-204150662 TAGGGAAACTGAGGCAGGAGAGG + Intronic
921042529 1:211447783-211447805 TAGGGCAGCTAAGGGAGGGCTGG + Intergenic
921389993 1:214607099-214607121 CAGGGAGGCTAAGGCAGAGCTGG - Intronic
922616850 1:226965756-226965778 CAGGGCAGGTGAGGCAGTCCAGG - Intronic
922626567 1:227051880-227051902 TAGTGAAGCTGAGCCAGTTAAGG - Intronic
923009956 1:230080765-230080787 TGGGGAAACTGAGGCACTGAAGG - Intronic
923469271 1:234276403-234276425 TCGTGTAGCAGAGGCAGTGCTGG + Intronic
924520336 1:244800889-244800911 TTGGGAGGCTGAGGCAGAGGTGG - Intergenic
1062856381 10:781446-781468 TGGGGAAGCCGGGGCACTGCTGG + Intergenic
1063737737 10:8779978-8780000 TAGGGGAGTTGAGGGAGTTCAGG - Intergenic
1064324161 10:14333226-14333248 TGGGGAAGGTGAGGCAGGGATGG + Intronic
1064583241 10:16815040-16815062 TAGGGAAGATGATGCATAGCGGG - Intronic
1064625908 10:17261043-17261065 GAGGGAGGCTGAGGGATTGCAGG + Intergenic
1065185860 10:23170872-23170894 TAGGGAAGCTCAGTTAGTACTGG - Intergenic
1065895294 10:30158066-30158088 TTGGGAAGCTGAGGCAGGTGAGG + Intergenic
1066500864 10:35993322-35993344 TTGGGATGCTGAGGTGGTGCAGG - Intergenic
1067901570 10:50247262-50247284 TCGGGAGGCTGAGGCAAGGCAGG - Intronic
1069884127 10:71612776-71612798 GGGTGAAGCAGAGGCAGTGCAGG - Intronic
1069991025 10:72316288-72316310 TGGGGAAACTGAGGCAGAGCAGG + Intergenic
1070168843 10:73917298-73917320 AAGTGAAACTGAGACAGTGCTGG - Exonic
1070923016 10:80200787-80200809 TTGGGAGGCTGAGGCGGGGCGGG + Intronic
1070939308 10:80329292-80329314 TGAGGAAGTTGAGGCAGAGCAGG + Intergenic
1070947966 10:80408712-80408734 TGGGGAAACTGAGGCAGTGCAGG + Intronic
1071332223 10:84571494-84571516 CAGGGAGGCTCAGGCCGTGCAGG - Intergenic
1071610965 10:87031049-87031071 CAGGGAGGCTCAGGCTGTGCAGG + Intergenic
1072859895 10:98992457-98992479 CAGGGAAGCTGAGGCCATGAGGG + Intronic
1073045183 10:100633125-100633147 TTGGGAAGCTGAGGCTGAGGCGG + Intergenic
1074185462 10:111096793-111096815 TGGGCAAGCTGAGGCAGAGGTGG - Intergenic
1074324946 10:112441084-112441106 TTGGGAGGCTGAGGCGGTGTGGG - Intronic
1074624651 10:115167982-115168004 TAGGGAAGACGAGGAAGTGTGGG - Intronic
1074712981 10:116192851-116192873 TGGGGAAACAGAGGCAGTCCCGG + Intronic
1075671110 10:124264780-124264802 GAGAGAAGCTGAGTCAGTGAAGG - Intergenic
1076024429 10:127100429-127100451 TAGGGAAGGCGAGGCAGCGGTGG + Intronic
1076163956 10:128267544-128267566 TAGGGAAACTGAGGCTCTGAGGG + Intergenic
1076338325 10:129725595-129725617 TTGGAAAGCTGTGGCCGTGCTGG - Intronic
1076449169 10:130544396-130544418 CAGGGAAGCAGTGGCAGTGAGGG + Intergenic
1077209954 11:1365648-1365670 TTGGGAAGCTGAAGAAGTTCTGG + Intergenic
1077209972 11:1365812-1365834 TTGGGAAGCTGAAGAAGTTCTGG + Intergenic
1077209982 11:1365894-1365916 TTGGGAAGCTGAAGAAGTTCTGG + Intergenic
1077210001 11:1366058-1366080 TTGGGAAGCTGAAGAAGTTCTGG + Intergenic
1077210011 11:1366140-1366162 TTGGGAAGCTGAAGAAGTTCTGG + Intergenic
1077383235 11:2257234-2257256 TAGGGAGGCTGAGACAGAGAAGG + Intergenic
1077487687 11:2846577-2846599 TAGGGCAGGTGAGGGAGTCCAGG - Intronic
1077535771 11:3123200-3123222 TGGGGAACCTGAGGCAGGGTAGG + Intronic
1077545612 11:3168294-3168316 TGGGGAAGCTGAGGCACAGCAGG + Intergenic
1078594300 11:12674001-12674023 TAGGGAAACTGAGGCACGGTAGG + Intergenic
1079080796 11:17412490-17412512 TAGGGAAACTGAGGCAGGCAAGG - Intronic
1079706910 11:23632708-23632730 TGGGGAAGCCAAGGCAGTGCTGG + Intergenic
1079823449 11:25160590-25160612 TGGGGAAGCTAAGAAAGTGCTGG - Intergenic
1080346898 11:31335373-31335395 AGGGGAAGCTGAAGCAGGGCGGG - Intronic
1081374666 11:42344401-42344423 TGGGGAGGCTCAGGCTGTGCGGG + Intergenic
1081643866 11:44776777-44776799 GAAGGTAGCTGAGGAAGTGCTGG + Intronic
1082837862 11:57664681-57664703 TAGGGCAGCAGAGGTAGAGCTGG + Intergenic
1083445234 11:62704012-62704034 TTGGGAGGCTGAGGCAAGGCAGG + Intronic
1083803316 11:65058866-65058888 GAGGGAGGCAGAGGCAGTGAGGG - Intergenic
1084101136 11:66950435-66950457 TAGGAAACCCGAGGTAGTGCTGG + Intronic
1084182801 11:67455089-67455111 TAGGGAAACTGAGGCTGGGAGGG + Intronic
1084590321 11:70086440-70086462 TAAGGAAACTGAGGCAGGGCAGG + Intronic
1084627005 11:70315814-70315836 TTGGGAAGATGAGGAAGTTCTGG - Intronic
1085442427 11:76577030-76577052 TAAGGAAGCTGAGACACTCCTGG - Intergenic
1085712286 11:78841191-78841213 TAAGGAAACTGAGGCACTGATGG + Intronic
1086309798 11:85522600-85522622 TTGGGAAGCTGTGGCTTTGCAGG - Intronic
1087336131 11:96847390-96847412 TAGGGAAGCAGAAGCACTACAGG + Intergenic
1088870133 11:113883719-113883741 TTGGGAGGCTGAGGCGGTGGTGG - Intergenic
1088884599 11:113997071-113997093 TTGGGAGGCTGAGGCAGGTCAGG - Intergenic
1089529248 11:119116010-119116032 AGGGGAAGCTGAGGCAGAGAGGG - Intronic
1089668341 11:120034421-120034443 GGGACAAGCTGAGGCAGTGCAGG - Intergenic
1090221008 11:125026067-125026089 TGGGGCAGCTAAGGGAGTGCAGG - Intronic
1090369606 11:126239618-126239640 TAGGGAGGCTGAGGCAGGAAAGG - Intronic
1090388840 11:126374140-126374162 TAGAGAAGCTGAGTAAGAGCTGG + Intronic
1090508271 11:127343008-127343030 TTGGGAAGCTGCGGCATAGCAGG + Intergenic
1090741617 11:129667097-129667119 TGGGGAAGATGAGCCAGTGCAGG - Intergenic
1091275565 11:134347121-134347143 GAGGGAAGCTGCAGGAGTGCGGG + Intronic
1091347470 11:134864815-134864837 ATGGGAACCTGAGACAGTGCTGG + Intergenic
1092418231 12:8308484-8308506 TAGGGAGGCTGAGGCGGCTCCGG - Intergenic
1092428552 12:8391875-8391897 TGGGGAAGCTCAGGGAGTACAGG - Intergenic
1093375129 12:18416468-18416490 TAGGGAAGATAAGTCAATGCTGG + Intronic
1093446643 12:19267414-19267436 TTGGGAGGCTGAGGCAGGTCAGG + Intronic
1095216883 12:39559263-39559285 TTGGGATGCTGAGGCAGGGCAGG + Intronic
1095611332 12:44132095-44132117 TAGGGAGACGGAGGCAGTGTAGG + Intronic
1095702291 12:45202657-45202679 TACGGAATCTGAGTCATTGCTGG - Intergenic
1096690272 12:53316341-53316363 TCAGGAGGCTGAGGCAGGGCAGG + Intronic
1097609282 12:61798496-61798518 TAGGGAAAATGAAGAAGTGCTGG - Intronic
1097964050 12:65560268-65560290 CAGAGAAGAAGAGGCAGTGCAGG - Intergenic
1098384791 12:69907446-69907468 GAAGGAAGCAGAGGCAGTGTTGG - Intronic
1100231568 12:92613710-92613732 TAGGGAAGCTGAGGGAGAAAAGG + Intergenic
1100794394 12:98164827-98164849 AAGGGGAACTGAGGCTGTGCTGG + Intergenic
1101628656 12:106471436-106471458 AAGGCAAGCTGAAGCAGGGCAGG - Intronic
1101892013 12:108725583-108725605 TAGGGGAACTGAGGCCGTGAGGG - Intronic
1102074996 12:110052748-110052770 TTGGGAAGCTGAGACAGAGTGGG + Intronic
1102297271 12:111746889-111746911 TTGGGAAGCTGAGGCATGGGAGG + Intronic
1102452071 12:113049405-113049427 TGGGGAAACTGAGGCAGTAGAGG - Intergenic
1102650638 12:114439877-114439899 TAGGGAAGTTCAGGGAGAGCTGG - Intergenic
1102842723 12:116143265-116143287 CAGGGAGGCCGAGGCAGGGCAGG + Intronic
1103038985 12:117679085-117679107 CAGAGAAGCTGAGCCAGAGCAGG - Intronic
1103467465 12:121153247-121153269 TTGGGAAGCTGAGACAGAGTGGG - Intronic
1104752867 12:131251105-131251127 GAGGGAGACGGAGGCAGTGCCGG + Intergenic
1105884586 13:24630913-24630935 GAGGCAAGCTGAGTCACTGCTGG - Intergenic
1106034664 13:26032931-26032953 TTGGGAAGCTGAAAGAGTGCTGG + Intergenic
1106308171 13:28531980-28532002 CAGGGGAGCAGAGGCAGGGCAGG - Intergenic
1109091491 13:58052078-58052100 TGAGGATGCTGAGGCTGTGCAGG - Intergenic
1109452275 13:62532752-62532774 TAGGGAAGGTGAGGAAGAGGTGG + Intergenic
1111042686 13:82770588-82770610 GAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1111365288 13:87235003-87235025 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1112247260 13:97746457-97746479 TCGGGAGGCTGAGGCACTTCGGG + Intergenic
1112427004 13:99311808-99311830 CAGGGAAGAAGAGGCAGTCCTGG - Intronic
1113597699 13:111546350-111546372 TGGGGAAGCTGAGGCAGGGCTGG + Intergenic
1113759997 13:112840456-112840478 TAGGGAGGCTGAGGCTGGGGGGG - Intronic
1113760018 13:112840521-112840543 TAGGGAGGCTGAGGCTGGGGGGG - Intronic
1114176610 14:20326550-20326572 TAGGGATGAGGAGCCAGTGCTGG - Intronic
1114338670 14:21719940-21719962 TTGGGAGGCTGAGACAGGGCGGG - Intergenic
1114595517 14:23908648-23908670 TTGGGAAGCTGAGGCGTTGGGGG - Intergenic
1114902864 14:27086767-27086789 TAGGGAAACTGAGTCATTGATGG - Intergenic
1115658630 14:35468079-35468101 TTGGGAGGCTGAGGCAGTGGGGG + Intergenic
1115693246 14:35868541-35868563 TTGGGAAGCTGAGGCAGGATTGG + Intronic
1116173036 14:41427389-41427411 TTGGGCAGCCAAGGCAGTGCAGG + Intergenic
1116574686 14:46557869-46557891 TAGGAAAGGTGAGGCAGCCCAGG + Intergenic
1116657025 14:47665858-47665880 CAGGGAGGCTGAGGCAACGCAGG - Intronic
1116950677 14:50875854-50875876 TTGGGAAGCAGAGGCAGTAGAGG - Intronic
1117401150 14:55359207-55359229 TTGGGAAGCTGAAGAAGAGCTGG - Intronic
1117629122 14:57671259-57671281 TGGGGCAGCTAAGGGAGTGCTGG + Intronic
1117683447 14:58228783-58228805 TCAGGAGGCTGAGGCAGAGCAGG - Intronic
1117732945 14:58742282-58742304 AAGGGTAGCTAAGGCATTGCAGG - Intergenic
1118731455 14:68669873-68669895 CAGGGAAACTGAGGCACAGCAGG - Intronic
1118817369 14:69323013-69323035 TAGGGAAGCAAAGGACGTGCTGG + Intronic
1119155252 14:72404420-72404442 TCTGGAATCCGAGGCAGTGCTGG - Intronic
1119703110 14:76768448-76768470 GAGGGAGGGTGAGGAAGTGCAGG + Intronic
1120215693 14:81679252-81679274 TGGGGAGGCTCAGGCTGTGCAGG + Intergenic
1120235630 14:81887759-81887781 TGGGGAGGCTGAGGCAGAGCTGG - Intergenic
1120323355 14:82993984-82994006 TGGGGAGGCTGAGGCAGGGCAGG - Intergenic
1120731410 14:88006451-88006473 TAGTGACGCAGAGGCAGTACAGG - Intronic
1121145436 14:91578271-91578293 CAGGGAGGCTCAGGCTGTGCCGG - Intergenic
1121485687 14:94312748-94312770 TAGAGATGCTAAGGCAGTCCAGG + Intronic
1121595650 14:95159827-95159849 TTGGGAAGCCGAGGCAGGTCAGG - Intergenic
1122216485 14:100208229-100208251 CAGGGAGGCTCAGGCTGTGCAGG + Intergenic
1122578359 14:102755902-102755924 CAGGGAAACTGAGGCAGAGGTGG + Intergenic
1122703643 14:103606884-103606906 TGGGGAGGCTGAGGCTGTGGTGG - Intronic
1122706285 14:103624177-103624199 GAGGGAGGCTGCGCCAGTGCCGG - Intronic
1123018615 14:105387185-105387207 TCGGGAGGCTGAGAGAGTGCAGG + Intronic
1123107019 14:105846399-105846421 CAGGGCAGCTGAGCAAGTGCAGG + Intergenic
1123190418 14:106564260-106564282 CAGGGAAGCTCAGGAACTGCGGG - Intergenic
1123694730 15:22870553-22870575 TTGGGAGGCTGAGGCAGAGGAGG - Intronic
1124291424 15:28456381-28456403 CAAGGAGGCTGAGGCAGAGCTGG - Intergenic
1125723698 15:41857317-41857339 CAGGCAGGCTGAGGCACTGCTGG - Exonic
1125749755 15:42020353-42020375 TGGGGAAACTGAGGCAGAGTTGG + Intronic
1126034577 15:44535162-44535184 TCAGGAAGCTGAGGCAGTTGAGG - Intergenic
1127169836 15:56289957-56289979 TATGGCAGCTGAGCCAGTTCTGG + Intronic
1127439026 15:58987734-58987756 TAGGGGAGCAGCGGCAGTGGCGG + Intronic
1128148736 15:65347822-65347844 TTGGGAGGCTGAGGCAAGGCAGG + Intronic
1128444381 15:67744040-67744062 TAGGGAAGCTGAGGCTCAGAGGG - Intronic
1128907203 15:71477742-71477764 GAGGGATGCTGATGCAGGGCAGG - Intronic
1129265462 15:74390998-74391020 TGGGGAAGCTGAGGCCGTACAGG - Intergenic
1129332723 15:74836011-74836033 TGCGGAAGCTGAGGTAGGGCCGG - Intergenic
1129459327 15:75692544-75692566 TGAGGAAGCTGAGGCAGTACTGG + Intronic
1129724633 15:77895342-77895364 TGAGGAAGCTGAGGCAGTACTGG - Intergenic
1130272655 15:82460126-82460148 AAATGAAGCTGAGGCAGTACTGG - Intergenic
1130465007 15:84187479-84187501 AAATGAAGCTGAGGCAGTACTGG - Intergenic
1130487681 15:84407325-84407347 AAATGAAGCTGAGGCAGTACTGG + Intergenic
1130499258 15:84486058-84486080 AAATGAAGCTGAGGCAGTACTGG + Intergenic
1130587297 15:85192093-85192115 AAATGAAGCTGAGGCAGTACTGG - Intergenic
1131237694 15:90711153-90711175 CAGGGAAGGCAAGGCAGTGCAGG - Intergenic
1131691923 15:94836467-94836489 TTGGGAGGCTGAGGCAGGGGGGG + Intergenic
1132666171 16:1082255-1082277 AAGGGAAGAAGAGGCTGTGCCGG - Intergenic
1132704438 16:1237058-1237080 TGGGGAAACTGAGGCAGAGAGGG - Intergenic
1132706301 16:1244878-1244900 TGGGGAAACTGAGGCACTGGTGG - Intergenic
1132707078 16:1249367-1249389 TGGGGAAACTGAGGCAGAGAGGG + Intergenic
1133369669 16:5238491-5238513 TGGGGAAGCTCAGGGAGTACAGG + Intergenic
1133393649 16:5429092-5429114 GAGGGAAACTGACCCAGTGCAGG - Intergenic
1133868794 16:9668851-9668873 GAGGGAGGCTGAGGCTGTGCTGG + Intronic
1134123661 16:11601676-11601698 TGGGGAGGCTGAGGCAGGGGAGG - Intronic
1135673761 16:24396664-24396686 CAGAGAAGCTGAGGGGGTGCTGG + Intergenic
1136111761 16:28067836-28067858 TGGTGCAGCTGTGGCAGTGCAGG - Intergenic
1137777554 16:51069077-51069099 TAGGAGAGCTAAGGCAGAGCTGG + Intergenic
1137837047 16:51602444-51602466 TAGGGAGGTTGAGGCAGGGGTGG - Intergenic
1138529371 16:57626823-57626845 TGGGGAAACTGAGGCAGAGGTGG + Intronic
1138560901 16:57800527-57800549 CTGGGAAGGTGAGACAGTGCAGG + Intronic
1138659500 16:58509025-58509047 TAGGGAAGCTGGCCCAGGGCTGG - Intronic
1139468418 16:67166055-67166077 TGCGGGAGCTCAGGCAGTGCGGG + Exonic
1139677635 16:68535946-68535968 GAAGGAAGCTGAAGCAGAGCCGG - Intronic
1139995658 16:70978028-70978050 TAGGGAACCGGAGCCACTGCTGG - Intronic
1140050922 16:71480294-71480316 CAGAGAGTCTGAGGCAGTGCTGG - Intronic
1140258270 16:73355632-73355654 TAAGGAAACTGAGGCACAGCAGG + Intergenic
1141669419 16:85484017-85484039 TGGGGAAACTGAGGCAGAGCTGG + Intergenic
1142032585 16:87845932-87845954 TGGGGAAGCTGGGGCTCTGCCGG - Intronic
1142282742 16:89156996-89157018 TAGGGAAACTGAGGCAGAGCAGG - Intergenic
1142441872 16:90103703-90103725 GAGGGAATCTGAGGCTGTGTGGG + Intergenic
1142812651 17:2402328-2402350 TAAGGAAACTGAGGCCGTGACGG + Intergenic
1142845405 17:2671442-2671464 TTGGGAGGCTGAGGCAGATCAGG - Intronic
1143099487 17:4497654-4497676 CAGTGAAGCTGTGGCAGGGCTGG - Intergenic
1143226630 17:5310424-5310446 TCGGGAGGCTGGGGCAGGGCAGG - Intronic
1144210917 17:13014821-13014843 TAGAGAAGAAGAGGCAGTTCTGG + Intronic
1144885954 17:18461889-18461911 TAGGGTAGCAAAGGCACTGCAGG - Intergenic
1145191127 17:20842719-20842741 CAGGGAGGCTGAGGCAGAGCTGG + Intronic
1146151536 17:30477386-30477408 TAGGGGAGCAGAGGCGATGCAGG - Exonic
1146272137 17:31491459-31491481 CAGGGAAGGGGAGGGAGTGCTGG + Intronic
1146323586 17:31866485-31866507 TTGGGAGGCTGAGGCAAGGCAGG + Intronic
1146643866 17:34563396-34563418 TAAGGAAGCTGAGGAAGTATGGG - Intergenic
1146679930 17:34799795-34799817 TAGGGAAGCTGAGACGGTGGGGG - Intergenic
1146892604 17:36515715-36515737 TTGGGGATCTGAGGCAGTGAAGG + Intronic
1147565296 17:41532626-41532648 TGGGGAAGCGGAGGCCGTTCAGG - Intergenic
1148841244 17:50498682-50498704 TGAGGAAACTGAGGCAGAGCAGG - Intergenic
1149108440 17:52997256-52997278 TGGGGAAGCCAAGGCAGTTCAGG + Intergenic
1149790228 17:59470350-59470372 TTGGGAAGCTGAGGGGGTGTGGG + Intergenic
1150097209 17:62387961-62387983 TTGGGAGGCTGAGGCAGGCCGGG + Intronic
1150479605 17:65499248-65499270 GAGGGACGCTGAGGGGGTGCTGG - Intergenic
1151157855 17:72139257-72139279 TAGGGAAGCTCAGGCATTTCTGG + Intergenic
1151297803 17:73198358-73198380 TTTGGAAGCTGAGGCAGTCCAGG + Intronic
1151983717 17:77528885-77528907 AACGGCAGCTGAGGCAATGCGGG + Intergenic
1152276635 17:79361779-79361801 TAGAGAAGCAGAGGAAGTGGAGG + Intronic
1152425106 17:80214434-80214456 TGGGGAAACTGAGGCAGTGAGGG - Intronic
1152919302 17:83057919-83057941 GAGGGAGGCCGAGGCAGAGCGGG - Intergenic
1154412813 18:14150507-14150529 TGGGGAAGCAGAGGCTGAGCTGG - Intergenic
1155251953 18:23961103-23961125 TAGGGAAGGTAAGGCAGTGGAGG - Intergenic
1155885864 18:31207219-31207241 CAGGGAGCCTGAGCCAGTGCAGG - Intergenic
1156057132 18:33020185-33020207 TTGGGAGGCTGAGGCAGGCCAGG - Intronic
1156079542 18:33316487-33316509 CAGGGAGGCTAGGGCAGTGCAGG - Intronic
1156112167 18:33741817-33741839 TGAGGAAACTGAGGCTGTGCAGG - Intronic
1156453487 18:37279823-37279845 TAAGGAAGCTGGGGCAGAGAAGG + Intronic
1156671294 18:39473475-39473497 TAGGGAAGCTGAGGCGGCAGAGG - Intergenic
1157928028 18:51787807-51787829 CAGGGGCGGTGAGGCAGTGCAGG + Intergenic
1157935145 18:51864428-51864450 CGGGGAGGCTCAGGCAGTGCAGG + Intergenic
1158140841 18:54253725-54253747 TCAGGAGGCTGAGGCAGGGCAGG + Intergenic
1158373974 18:56842063-56842085 CAGGGAAGATGAAGCAGTGAGGG - Intronic
1158516893 18:58138284-58138306 GAGTGATGCTGAGGCATTGCTGG + Intronic
1159117835 18:64135818-64135840 TTGGGAAGCCGAGGCAGGCCTGG - Intergenic
1160793151 19:932324-932346 GAGGGAAACTGAGGCTGGGCGGG + Intronic
1160824413 19:1073033-1073055 TGGGGAAACTGAGGCAGAGGTGG - Intronic
1160833247 19:1113008-1113030 TAGGGAAGCTGAGACACGGGTGG - Intronic
1160995074 19:1878704-1878726 CAGGGAGGCCGAGGCAGAGCTGG - Intronic
1161151270 19:2711290-2711312 TAGGGAAGCTGAGGTCCTGTGGG + Intergenic
1161314023 19:3609460-3609482 TGGGGAAACTGAGGCAGGGACGG + Intergenic
1161478333 19:4498447-4498469 TCGGGAAACTGAGGCAAAGCCGG + Intronic
1161491345 19:4563604-4563626 TTGGGAAGCTGAGAAAGTTCTGG - Intergenic
1161592089 19:5133487-5133509 TAGGGCAGCCGGGGCAGGGCTGG + Intronic
1161828613 19:6586445-6586467 TAGGGAAACTGAGGCACAGGGGG + Intronic
1162009901 19:7806599-7806621 TTGGGAGGCTGAGGCAGGGTTGG - Intergenic
1162484552 19:10951287-10951309 TTGGGAGGCTGAGGCAGAGGCGG - Intergenic
1162495036 19:11018801-11018823 TAGGGCAGCTGAGGGAGGGAGGG - Intronic
1162784919 19:13028659-13028681 AAGGGAGGTTGAGGCAGGGCAGG + Intronic
1162884492 19:13686219-13686241 TTGGGAGGCTGAGGCAGGGCGGG + Intergenic
1162889292 19:13720832-13720854 TTGGGAGGCTGAGGCAGGACTGG - Intergenic
1163157725 19:15448599-15448621 TGGGTAAACTGAGGCAGTGCAGG - Intronic
1163281936 19:16323836-16323858 CAGGGAAACTGAGGCAGAGGTGG - Intergenic
1163311259 19:16516191-16516213 TTGGGAAGCTGAGGCAGGGTGGG + Intronic
1163799638 19:19356732-19356754 CAGGGAAGGTGAGGCGGTGGAGG - Exonic
1164492419 19:28727418-28727440 CGGGGAAGCTGAGGCAGAGAGGG + Intergenic
1164511010 19:28897263-28897285 TGGGGAGGCTGAGGAAGGGCGGG - Intergenic
1164734758 19:30532637-30532659 AAGGGAAGCTGAGGGAGGCCGGG + Intronic
1165082602 19:33317778-33317800 TTGGGAGGCTGAGGCGGTGGGGG + Intergenic
1165312614 19:35038038-35038060 CAGGGAAGCTGGGGCAGGGCAGG + Intronic
1166222114 19:41372089-41372111 TTGGGAGGCTGAGGCAGTAGGGG + Intronic
1166291645 19:41867413-41867435 CTGGGAGGCTGAGGCAGGGCAGG - Intronic
1166563238 19:43747407-43747429 TGCGGAAGCTCAGGCAGGGCAGG + Intronic
1167119496 19:47508053-47508075 GAGGGAAGCCTAGGCAGTACAGG - Intronic
1167647433 19:50713361-50713383 GAGGGGAGCTGGTGCAGTGCTGG + Intronic
926216054 2:10905962-10905984 TGGGGAAGCTGAGCCAGGTCAGG - Intergenic
927186327 2:20485155-20485177 TAGGGGAACTGAGACAGTGGTGG + Intergenic
927192648 2:20527396-20527418 TGGGGAAACTGAGGCAGTAGGGG + Intergenic
927840295 2:26437416-26437438 GAGGGAACCTGGGGCAGGGCAGG - Intronic
927887397 2:26727115-26727137 AAGGGAGACTGAGGCAGGGCTGG - Intronic
928228342 2:29475063-29475085 TAGGGAAGATGAGTGAGTGGAGG - Intronic
928338290 2:30417867-30417889 TTGGGAAGTTGAGGCAGGACAGG + Intergenic
928880617 2:36092537-36092559 TGGGGAGGCTCAGGCTGTGCAGG - Intergenic
929102079 2:38324925-38324947 TGGGGAAGATGAAGCAGTTCTGG + Intronic
929144102 2:38691434-38691456 TTGGGAGGCTGAGGCAGAGGAGG + Intronic
929388719 2:41442843-41442865 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
929926619 2:46217547-46217569 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
931516673 2:63054229-63054251 TAGGGGAGCTGAGGCTGCTCGGG + Intronic
932333524 2:70915334-70915356 TTGGGAGGCTGAGGCAGGGAAGG - Intronic
932440334 2:71730893-71730915 AAGGGAGGCAGAAGCAGTGCTGG + Intergenic
933845404 2:86322555-86322577 TTGGGAGGCTGAGCCAGGGCAGG - Intronic
933845485 2:86323089-86323111 TTGGGAGGCTGAGCCAGGGCAGG + Intronic
934704043 2:96463876-96463898 GGGGGAAGCAGAGGCAGGGCTGG + Intergenic
934757058 2:96831844-96831866 AGGGGAAGCTGAGGGAGAGCTGG - Intronic
938030944 2:127992524-127992546 TTGGGAGGCTGAGGCAGGGCAGG - Intronic
938891612 2:135711424-135711446 TTGGGAAGCTAAGGCAGACCTGG + Intronic
939067865 2:137505806-137505828 TCAGGAAGCAGAGGGAGTGCAGG + Intronic
939347900 2:140991460-140991482 TAGGGAAGATGACATAGTGCTGG + Intronic
941178963 2:162235212-162235234 TGGGGAGGCTCAGGCCGTGCAGG - Intronic
941407575 2:165110073-165110095 TGGGGAAGCGGAGGGAGGGCAGG - Intronic
941891450 2:170585949-170585971 TTGGGAGGCTGAGGCAGGCCAGG + Intronic
943226840 2:185188506-185188528 TGGGGCAGCTAAGGCAGTGCTGG - Intergenic
943583476 2:189711766-189711788 TGGGTGAGCTGAAGCAGTGCAGG + Intronic
944948859 2:204723707-204723729 AAGGGGAGTTGAGGCAGTGAGGG + Intronic
945219980 2:207473605-207473627 TAGGGGGGCTGAGGAAGTGAAGG + Intergenic
946084891 2:217160847-217160869 TTGGGAGGCTGAGGCAGGTCAGG + Intergenic
946401894 2:219472618-219472640 TAGGGAAACTGAGGCAGAGCGGG - Intronic
946929191 2:224655600-224655622 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
947103840 2:226648310-226648332 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
947980379 2:234403633-234403655 TAGGGAAACTGAGGCATGGAAGG - Intergenic
948156599 2:235788462-235788484 GAGGGAAGGTGAGGCAGGGTGGG + Intronic
948569958 2:238911531-238911553 GATGGAAGCTGAGGCCATGCTGG - Intergenic
948820132 2:240538567-240538589 CGGGGAGGCTGGGGCAGTGCAGG - Intronic
948825561 2:240572057-240572079 TAGGGAAACTGAGGCACAGTAGG - Intronic
1169586964 20:7096258-7096280 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1170048674 20:12115118-12115140 TAGGGAAGCAAAGACAGAGCAGG + Intergenic
1171047779 20:21827070-21827092 TGAGGAAGCTGAGGCTCTGCGGG - Intergenic
1171258381 20:23709672-23709694 TAGGGATGCTGAGGGTGAGCAGG - Intergenic
1171275614 20:23854706-23854728 TAGGGATGCTGAGGGTGAGCAGG - Intergenic
1172022408 20:31924017-31924039 TAGAGAAGCTGAGGCATGGTGGG - Intronic
1172311454 20:33921464-33921486 AATGGTAGCTGAGGCAGTGGTGG - Intergenic
1172484454 20:35290078-35290100 CAGGGAAACTGAGGCAGGACTGG - Intronic
1172554512 20:35829163-35829185 CAGGGAATCTGAGAGAGTGCAGG + Intronic
1172598029 20:36163948-36163970 TAGGGAGGCTGAGGCAGACCTGG - Intronic
1172705671 20:36880530-36880552 CTGGGAAGCTGGGGCAGAGCTGG - Intronic
1173450813 20:43162375-43162397 TAAGGAAACTGAGGCAGAGGTGG + Intronic
1174272668 20:49380889-49380911 TAGGGAAACTGAGGCACAGAGGG - Intronic
1174746815 20:53071901-53071923 TTGGGGAGCTGGGGCAGTACAGG - Intronic
1174865501 20:54131699-54131721 AAGTGAAACTGAGGCAGTGAAGG + Intergenic
1175259372 20:57664917-57664939 TAGGGAAACTGAGGCAGGATTGG - Intronic
1176094238 20:63332655-63332677 TAGGGCAGCTGAGGGGGTGGTGG - Intronic
1176249705 20:64114670-64114692 GCGGGCAGCTGGGGCAGTGCTGG + Intergenic
1176876559 21:14135823-14135845 TAGGGAAGTTAAGGGAGTACTGG + Intronic
1176899266 21:14419986-14420008 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1176916937 21:14636740-14636762 TCGGGAGGCTGAGGCGGTGGCGG + Intronic
1177577872 21:22982405-22982427 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1178687357 21:34722229-34722251 TTGGGAGGCTGAGGCAGGGGTGG - Intergenic
1180170237 21:46054808-46054830 GAGGGAGGCAGAGGCTGTGCGGG - Intergenic
1180181550 21:46120609-46120631 TAGGGGATCTGAGGGGGTGCAGG + Intronic
1180711379 22:17841901-17841923 GAGGCAGGCTGAGGCACTGCAGG - Exonic
1180716442 22:17875819-17875841 GAGGGAGGCCGAGGCTGTGCCGG - Intronic
1180840963 22:18958650-18958672 AAGGGAAACTGAGGCACAGCTGG + Intergenic
1181060526 22:20280125-20280147 AAGGGAAACTGAGGCACAGCTGG - Intronic
1181129340 22:20721189-20721211 TCGGTGAGCTGGGGCAGTGCAGG + Intronic
1181334098 22:22116268-22116290 CAGGGAGGCCGAGGCAGAGCTGG - Intergenic
1181582204 22:23834633-23834655 TTGGGAATCTGAGGCAGAGGAGG - Exonic
1181989796 22:26828871-26828893 TGGGGAAGCTCAGGCAGCGGTGG + Intergenic
1182298702 22:29326339-29326361 CAGGGAAACTGAGGCAGGGAGGG - Intergenic
1182479423 22:30597162-30597184 TGGGGAGGCTTAGGCTGTGCCGG - Intronic
1182575602 22:31270934-31270956 CAGGGAAGCAGAGGAAGTCCAGG + Intronic
1182900722 22:33896031-33896053 TTGGGAAGATGAAACAGTGCTGG - Intronic
1182983852 22:34698304-34698326 TAGAGAAGCTGGCGCAGGGCAGG - Intergenic
1183013321 22:34965556-34965578 TTGGGAGGCTGAGGCAGGGAAGG - Intergenic
1183253182 22:36744455-36744477 TGGTGAAGCTGAGGCAGGACTGG + Intergenic
1183306788 22:37087033-37087055 TAGGGAAACTGAGGCCCTACCGG + Intronic
1183364250 22:37398921-37398943 TAGGGGAGCTGAGGAATTACAGG - Intronic
1183587204 22:38759769-38759791 AAGGGAGGCTGGGGCAGCGCTGG + Intronic
1183650095 22:39148806-39148828 GAGGGAAGCTGAGGCACTGTGGG + Intronic
1183658863 22:39206828-39206850 TGGGGAAACTGAGGCAGGGGTGG - Intergenic
1183735367 22:39642085-39642107 CAGGGCAGCAGAGGCAGCGCAGG - Intronic
1184331900 22:43832824-43832846 TGGGGAGGGTGAGCCAGTGCTGG - Intronic
1184471129 22:44697132-44697154 TGGGGAAACTGAGGCTGTGTGGG - Intronic
1184492578 22:44818584-44818606 TGGGGAAACTGAGGCAGAGAGGG - Intronic
1184549159 22:45195299-45195321 GTGGGAAGATGAGGCAGTCCAGG - Intronic
1184749324 22:46475511-46475533 TTGGGAAGATGAGGAAGTTCTGG + Intronic
1184756175 22:46517145-46517167 TGGGAAAACTGAGGCAGTGGGGG - Intronic
1184758064 22:46527986-46528008 TTGGGAAGCTGAGGCAGCTGAGG + Intronic
1185364873 22:50432866-50432888 TGGGGAAGCAGAGGCCGAGCTGG + Intronic
949690441 3:6630990-6631012 TTGGGAGGCTGAGGCAATGCAGG - Intergenic
949917864 3:8978550-8978572 TACTGAAGCTGAGGAGGTGCAGG + Intergenic
949996249 3:9619650-9619672 ATGGGAAGCAGAAGCAGTGCTGG + Intergenic
950448408 3:13051761-13051783 GAGGGAAACTGAGGCAGGGAGGG - Intronic
951017967 3:17750024-17750046 TAGAGAAGGAGAGGCAGTGTAGG - Intronic
951032309 3:17895881-17895903 TAGGGCAGCCAAGGGAGTGCCGG - Intronic
951214017 3:20006706-20006728 TTGGGAGGCTGAGGCAGGGCGGG - Intronic
951566917 3:24020136-24020158 GAGGGGGGCTGAGGCAGTGGGGG + Intergenic
952578563 3:34804111-34804133 TAGGAAAGCTGATGCTGTGATGG + Intergenic
952956862 3:38563001-38563023 TGGGGAAGAAGAGGCAGTCCTGG + Intronic
953019410 3:39104213-39104235 TAGGGCAGCTGAGCCACTGGGGG - Intronic
953189198 3:40667970-40667992 AAAGAAAGCTGAGGCAGAGCTGG + Intergenic
953401000 3:42616996-42617018 TTGGGAGGCTGAGGCAGGGAGGG - Intronic
953507598 3:43501507-43501529 TAGAGAATCTGAAGCAGTGAAGG + Intronic
953654155 3:44835483-44835505 TTGGGAGGCTGAGGCAGGGGAGG - Intronic
953749168 3:45596133-45596155 TAGGGGAGCTGGGGCTGTCCAGG - Exonic
954128826 3:48549413-48549435 AAGGGAACCTGAGTGAGTGCAGG - Intronic
954134017 3:48573775-48573797 CAAGGAAACTGAGGCAGTACTGG + Intronic
954286352 3:49622143-49622165 TAGGGAGGCTGAGGTTGTGCAGG + Intronic
954365796 3:50145362-50145384 GAGGGAAGCTGGGGCTGAGCAGG + Intergenic
954438594 3:50509257-50509279 GAGGGTAGCTGAGGCAGTGAAGG - Intergenic
954488116 3:50873525-50873547 TAGGGTAGCTAAGAAAGTGCTGG - Intronic
955298548 3:57756340-57756362 AAGGTAAGCTGAGGCGGTGGTGG + Exonic
955399246 3:58579488-58579510 TGGGGAAGTTAAGGCAGAGCAGG - Intronic
955407518 3:58634800-58634822 TGGGGAAGCTGAGGCACAGAGGG + Intronic
955705564 3:61724124-61724146 TTGGGAGGCTGAGGCACTGGAGG + Intronic
955798836 3:62665692-62665714 TGGGGAGGCTGTAGCAGTGCTGG + Intronic
957073257 3:75581589-75581611 TGGGGAAGCTCAGGGAGTACAGG - Intergenic
958543247 3:95508175-95508197 TCAGGAGGCTGAGGCAGGGCAGG + Intergenic
958758175 3:98275005-98275027 ATGGGAAGCAGAGGCAGGGCCGG + Intergenic
959287134 3:104429033-104429055 TATGGAAGATGTGCCAGTGCTGG + Intergenic
959941481 3:112086204-112086226 TAGAGCACCTGAGGCCGTGCCGG - Intergenic
960846640 3:122009975-122009997 TAGAGACTCTGCGGCAGTGCAGG + Intronic
961280826 3:125765189-125765211 TGGGGAAGCTCAGGGAGTACAGG + Intergenic
961873566 3:130004395-130004417 TGGGGAAGCTCAGGGAGTACAGG - Intergenic
961895920 3:130167694-130167716 TAGGGAGGCTGAGGCGGCTCCGG - Intergenic
961992011 3:131202267-131202289 AAGGCAAGCTGAAGCAGGGCAGG + Intronic
962177199 3:133167459-133167481 CAGGGAAGCTCGGGCCGTGCAGG + Intronic
962251105 3:133836645-133836667 CAGGGAAGCAGAGGGAGGGCAGG - Intronic
962379384 3:134885186-134885208 GATGGAAGATGAGGCATTGCAGG + Intronic
963589958 3:147245708-147245730 TAGGGAGGCTCAGGCATGGCAGG + Intergenic
964491286 3:157239257-157239279 AAGGCAGGCTGATGCAGTGCTGG - Intergenic
964537399 3:157738869-157738891 GAGGGAAGTTGGGTCAGTGCCGG - Intergenic
966348486 3:179004512-179004534 TAGGGCAACTAAGTCAGTGCTGG + Intergenic
967245712 3:187484311-187484333 TAGGGAAACTGAGGCAGTCTAGG - Intergenic
967389693 3:188943390-188943412 GGGGAAAGCTGAGACAGTGCTGG + Intergenic
968070028 3:195779019-195779041 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070107 3:195779451-195779473 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070163 3:195779739-195779761 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070180 3:195779835-195779857 TGTGGAAGCTGAGGAAGTGTCGG + Exonic
968070271 3:195780315-195780337 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070608 3:195782139-195782161 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070689 3:195782571-195782593 TATGGATGCTGAGGAAGTGTCGG + Exonic
968070906 3:195783819-195783841 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968070974 3:195784203-195784225 TGTGGATGCTGAGGAAGTGCTGG + Exonic
968181568 3:196599136-196599158 GTGGGAAGCTCAGGCAGGGCGGG + Intergenic
968218120 3:196911652-196911674 TTGGGAAGCTGAGGCAGTTGTGG + Intronic
968362139 3:198154670-198154692 GAGGGAATCTGAGGCTGTGTGGG + Intergenic
968969110 4:3784319-3784341 GAGGGAAGCTGGTGCACTGCTGG - Intergenic
969006055 4:4021010-4021032 TAGGGAGGCTGAGGCGGCTCCGG - Intergenic
969305327 4:6323127-6323149 TAGGAAAGCTGGGGCAGGGAGGG + Exonic
969806893 4:9616280-9616302 TAGGGAGGCTGAGGCGGCTCCGG + Intergenic
970803559 4:20004273-20004295 TAGGGAGGCTCAGGCATGGCGGG - Intergenic
971146463 4:23981849-23981871 TAGGGAAGCTAAGGAGATGCTGG + Intergenic
971155564 4:24078080-24078102 TGAGGAAACTGAGGCAGTGCAGG - Intergenic
971249200 4:24958348-24958370 TAGGTAGTCTGAGGCACTGCAGG - Intronic
971564166 4:28117240-28117262 TGGGGAGGCTGAGGCATGGCGGG + Intergenic
972885201 4:43476804-43476826 TGGGGATGCTAAGGGAGTGCTGG - Intergenic
973086352 4:46066542-46066564 TATGGAAACTGAGCCACTGCAGG + Intronic
973209010 4:47594325-47594347 TTGGAATGCTGAGGCAGTCCAGG + Exonic
973941594 4:55916485-55916507 TTGGGAGGCTGAGGCGGGGCGGG - Intergenic
973951434 4:56018649-56018671 TCGGGAGGCTGAGGCAGGGAAGG + Intronic
973954987 4:56054420-56054442 TTGGGAGGCTGAGGCAAGGCAGG - Intergenic
974147750 4:57967489-57967511 CAGGGAGGCTGGGGCCGTGCAGG - Intergenic
974892254 4:67896616-67896638 TGGGGAGGCTGGGGCCGTGCAGG + Intergenic
974993577 4:69125085-69125107 GTGAGAAGCTGAGGCTGTGCTGG - Intronic
975017114 4:69435724-69435746 CAGAGACGCTGAGGCTGTGCTGG - Intergenic
976451945 4:85200108-85200130 TGGGGAAGCCAAGGGAGTGCTGG - Intergenic
977026858 4:91830837-91830859 TAGGGCAGCTAAGGTAGTGCTGG - Intergenic
978030004 4:103929863-103929885 TTGGGAGGCTGAGGCAGGGAGGG - Intergenic
978058968 4:104312140-104312162 CAGGGTAGCTAAGGAAGTGCTGG + Intergenic
978205352 4:106074085-106074107 TGGGCAAGCTGAAGCAGGGCAGG - Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
985376654 4:189347539-189347561 TGGGGAAGCTGAGTCAGAGAAGG + Intergenic
985668895 5:1196324-1196346 TTGGGAAGCTCAGGCGGTGGTGG + Intergenic
986124377 5:4871778-4871800 AAGGGAAGCTGAGGAAGAGGGGG + Intergenic
986233882 5:5889967-5889989 TTGGGAAGCTGAGGCAGGAGAGG + Intergenic
986327341 5:6686091-6686113 TAGCAAAGGTGAGGCAGGGCAGG + Intergenic
987373892 5:17217412-17217434 GAGGGGAGCAGAGGGAGTGCAGG + Intronic
988169813 5:27639148-27639170 TGGGGTAGCTAAGGGAGTGCTGG - Intergenic
988521565 5:31950002-31950024 TAGAGAATCTGATGCAGTTCTGG - Intronic
988956411 5:36324352-36324374 TGGGGTAGCTAAGGGAGTGCTGG - Intergenic
990042777 5:51392758-51392780 AAGGGAAGCTGAGGCAGGAGTGG + Intronic
990971002 5:61505851-61505873 TAAGGAAGCTGAGGCAGGAGTGG - Intronic
992268254 5:75039194-75039216 TAGGGAGGCTGAGGCAGGAGAGG - Intergenic
992343539 5:75851754-75851776 TGGGGAGGCTGAGGCAGCGGAGG - Intergenic
993009085 5:82459303-82459325 CAGGAAAGGTGAGGCAGTTCAGG - Intergenic
995730759 5:115239147-115239169 CTGGGAGGCTGAGGCAGGGCAGG - Intronic
997294468 5:132761085-132761107 TGGGGAAGCTGAGGGAGGGAAGG - Intronic
997300104 5:132797378-132797400 TTGGGAGGCTGAGGCAGGGAAGG + Intronic
997523633 5:134538961-134538983 TCGGGAAGCTGAGGCAGGAGAGG - Intronic
999110047 5:149111448-149111470 TTGGGAGGCTGAGGCAGGGAGGG + Intergenic
999134913 5:149312138-149312160 TGGGGGAGCTGAGGGAGTGGAGG + Exonic
999155499 5:149454759-149454781 TCGGGAGGCTGAGGCAAGGCAGG + Intergenic
999730625 5:154474465-154474487 TACGGAGCCTGAGGCTGTGCAGG - Intergenic
1000270139 5:159676639-159676661 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1000270206 5:159677039-159677061 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1000651399 5:163822516-163822538 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1001947617 5:175793550-175793572 TAGAGAACCTGAGACAGTGTAGG - Intergenic
1002368158 5:178729387-178729409 TCAGGAAACTGAGGCAGCGCCGG + Intronic
1002385167 5:178860661-178860683 TCAGGAAACTGAGGCAGCGCCGG - Intronic
1002430855 5:179203084-179203106 GAGGGAAACTGAGGCAGTGCAGG + Intronic
1002778514 6:348904-348926 TAGGTCAGCGGAGCCAGTGCCGG - Exonic
1003176900 6:3758416-3758438 CGGGGAGGCTGGGGCAGTGCAGG - Intergenic
1003381535 6:5628792-5628814 TAGGGAATCTGAGGAAGGACTGG - Intronic
1003868821 6:10385737-10385759 TAGGGAAACTGAGGTACTGCTGG + Intergenic
1005343334 6:24864195-24864217 TTGGGAAGCTGAGGCAGGAGAGG + Intronic
1006644320 6:35505731-35505753 TCGGGAAGCTGAGGTGGGGCTGG - Exonic
1007101458 6:39250283-39250305 GCGGGATCCTGAGGCAGTGCAGG - Intergenic
1007346402 6:41232815-41232837 AAGCGAAGCTCAGGCAGTGATGG + Intronic
1007748077 6:44055386-44055408 TAGGGAAACTGAGGCACAGAGGG - Intergenic
1007753233 6:44082634-44082656 ATGGGAAGCTGAGGCTGAGCAGG + Intergenic
1008087225 6:47257929-47257951 TAGGGAATGTGATGCAGTGGAGG + Intronic
1008177686 6:48288591-48288613 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
1008230919 6:48984163-48984185 TGGGGAGGCTGAGGCATGGCGGG - Intergenic
1008250394 6:49232452-49232474 GGGGGAAGCTAAGGGAGTGCTGG - Intergenic
1008312100 6:49989379-49989401 TAGGGCAGCTAAGGAAGGGCTGG + Intergenic
1008554183 6:52658874-52658896 TTGGGAGGCGGAGGCGGTGCGGG + Intergenic
1009444414 6:63723912-63723934 TCGGGAAACTGAGGCAGCCCGGG - Intronic
1009664293 6:66655472-66655494 CAGGGAGGCTCAGGCTGTGCAGG + Intergenic
1010154636 6:72778429-72778451 TCGGGAAGCTGAGGTGGTGGGGG + Intronic
1010327999 6:74587614-74587636 TGGGGCAGCCGAGGGAGTGCTGG + Intergenic
1010528823 6:76941699-76941721 TAAGGCAGCTAAGGGAGTGCTGG + Intergenic
1011082777 6:83507904-83507926 TCGGGAGGCTGAGGCAGGGCGGG + Intergenic
1011129291 6:84037540-84037562 TGGGGAGGCTCGGGCAGTGCGGG + Intronic
1011611206 6:89151984-89152006 GTGGGAAGCTGAGGCAGAGGAGG + Intronic
1011824275 6:91288001-91288023 TAAGGAAGCTAATGCAGTCCAGG + Intergenic
1012189435 6:96261595-96261617 TAGGGCAGCTAAGGGAGTGCTGG + Intergenic
1012486323 6:99725685-99725707 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
1013002099 6:106033249-106033271 TTGGGAAGCTGAGGTGGTGGTGG - Intergenic
1013415941 6:109924566-109924588 CAGAGAAGCTGAGGCAGAGAGGG + Intergenic
1015607498 6:134973708-134973730 TCGAGAGGCTGAGGCAGTTCCGG + Intronic
1015840431 6:137471186-137471208 TAGGGAAACTGAGGCATTGAGGG + Intergenic
1017407596 6:154136620-154136642 TGGGGATGCTGCGCCAGTGCAGG - Intronic
1018443710 6:163835806-163835828 TAGGAAGGCTGAGTCACTGCCGG - Intergenic
1018945432 6:168344624-168344646 TATGGAAACTGAGGCACTGAGGG - Intergenic
1019253541 7:34037-34059 GAGGGAATCTGAGGCTGTGTGGG - Intergenic
1019258884 7:68919-68941 TAGGGAAGGAGAGGCTGGGCTGG + Intergenic
1019299466 7:296136-296158 TAGGGGTGGTGAGGCAGTGCCGG - Intergenic
1019476843 7:1248436-1248458 TGGGGAAACTGAGGCAGAGGCGG - Intergenic
1019570283 7:1708211-1708233 TAGGGAAACTGAGGCTGAGAAGG - Intronic
1019924425 7:4182749-4182771 TAGGGAGGGAGAGGCAGAGCTGG + Intronic
1021106514 7:16645308-16645330 TGGGGAGGCAGAAGCAGTGCTGG - Intronic
1021444680 7:20719650-20719672 CAGGGAAGCAGAGCCAGAGCAGG + Intronic
1021717414 7:23471816-23471838 TACGGAAACGAAGGCAGTGCTGG + Intergenic
1021996863 7:26187454-26187476 TCGGGAGGCTGAGGCAGTCCAGG - Intergenic
1022385789 7:29898004-29898026 TGGGGAAGTGGAGGCAGTGTTGG - Intronic
1023248942 7:38237055-38237077 TGGGGAAACTGAGGCAGAGGGGG - Intergenic
1023820958 7:43980293-43980315 TAGGGGAGCTGAGTGGGTGCAGG + Intergenic
1024170225 7:46777650-46777672 CAGGGCAGCTAAGGGAGTGCTGG + Intergenic
1025008349 7:55373539-55373561 TTGGGAAGCTGAGGCAGGACAGG - Intronic
1025619767 7:63157882-63157904 TTGGGAGGCTGAGGCAGGCCAGG + Intergenic
1025995987 7:66527982-66528004 TGGGGAAACTGAGGCACTGAGGG - Intergenic
1026141887 7:67713504-67713526 TAGGGGAGCTGATGCAGGGATGG - Intergenic
1026514852 7:71059901-71059923 TTGGGAGGCTGAGGCAGTGGTGG + Intergenic
1026772379 7:73210813-73210835 TAGGGAAACTGAGGCACTTTGGG - Intergenic
1026921493 7:74158922-74158944 TTGGGAAGCTGAGGCAGAAGGGG + Intergenic
1026987633 7:74564815-74564837 TGGGGAAACTGAGGCACTGAAGG - Intronic
1027013247 7:74764212-74764234 TAGGGAAACTGAGGCACTTTGGG - Intergenic
1027074793 7:75181822-75181844 TAGGGAAACTGAGGCACTTTGGG + Intergenic
1027185166 7:75966771-75966793 TGGGGAAGATGAGGGAGGGCGGG - Intronic
1027328340 7:77065281-77065303 TAGGGGAGCTGAGTGGGTGCAGG - Intergenic
1027356288 7:77359078-77359100 TTGGGAGGCTGAGGCAGAGGTGG + Intronic
1028950658 7:96631115-96631137 AGGGGAAGCTAAGGGAGTGCTGG - Intronic
1029206192 7:98870388-98870410 TGGGGACGCTGAGTCAGAGCCGG - Intronic
1029744072 7:102506968-102506990 TGGGGAAACTGAGGCTCTGCAGG + Intronic
1029749231 7:102533733-102533755 TAGGGGAGCTGAGTGGGTGCAGG + Intergenic
1029767174 7:102632837-102632859 TAGGGGAGCTGAGTGGGTGCAGG + Intronic
1030278412 7:107744178-107744200 TAAGGAGGCGGAGGCAGTGGGGG + Intronic
1030834195 7:114263246-114263268 AATGGAAGATGAGGCAGTTCTGG - Intronic
1031280852 7:119797634-119797656 TGGGGAAGCCAAGGGAGTGCTGG - Intergenic
1031446597 7:121862566-121862588 CAGGGATGGTGAGACAGTGCAGG - Intergenic
1032459738 7:132101825-132101847 GAGGGAAGCTGAGTCTGTGTAGG + Intergenic
1032548290 7:132761762-132761784 TGGGGAAACTGAGGCAGGGTGGG + Intergenic
1032602308 7:133310819-133310841 TATGGAAGCTGAAGGAGTCCAGG - Intronic
1033486362 7:141792779-141792801 TAGAGAGCCTGTGGCAGTGCTGG + Intergenic
1033691251 7:143739940-143739962 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1034169309 7:149050473-149050495 TATGGGAGATGAGGCAGTGGGGG - Intergenic
1034590334 7:152132949-152132971 CTGTGAAGCTGAGGGAGTGCTGG + Intergenic
1035027529 7:155835846-155835868 TAGGGATGCTGAGGAGGTGTGGG - Intergenic
1035893738 8:3374198-3374220 TTGGGAGGCTGAGGCGGGGCAGG - Intronic
1036242182 8:7090640-7090662 TGGGGAAGCTCAGGGAGTACAGG + Intergenic
1036258595 8:7223318-7223340 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036308024 8:7616190-7616212 TGGGGAAGCTCAGGGAGTTCAGG + Intergenic
1036310650 8:7681914-7681936 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036358880 8:8064191-8064213 TGGGGAAGCTCAGGGAGTTCAGG + Intergenic
1036648347 8:10625871-10625893 AGGGGAGGCTGAGTCAGTGCAGG + Intronic
1036892078 8:12602761-12602783 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036899623 8:12660736-12660758 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036900694 8:12666883-12666905 TGGGGAAGCTCAGGGAGTACAGG - Intergenic
1038013615 8:23494554-23494576 TAGGGAAACTGAGGCATGGCAGG - Intergenic
1038495543 8:27999523-27999545 TAGGGAAGCTGAGGCCCAGCTGG - Intergenic
1038693629 8:29785336-29785358 TAAGGAAACTGAGGCAGGGAAGG + Intergenic
1039430437 8:37521382-37521404 TGGAGAAGCAGAGGCAGTGCAGG + Intergenic
1039561077 8:38513091-38513113 TGGGGCAGCAGAGGCAGCGCAGG - Intronic
1040000915 8:42575504-42575526 CAGGGAGGCTCAGGCAGTGCAGG - Intergenic
1040107424 8:43548647-43548669 GAGGGAAGTTGAGGCAGACCTGG - Intergenic
1040275628 8:46012312-46012334 AGGGGAGGTTGAGGCAGTGCAGG - Intergenic
1040511579 8:48100615-48100637 CAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1041292004 8:56317069-56317091 CAGGTAGGCAGAGGCAGTGCAGG - Intronic
1041654150 8:60331641-60331663 TTGGGAGGCTGAGGCGGGGCAGG + Intergenic
1045153967 8:99444888-99444910 TTTGGAAGCTGAGGCAGCCCAGG - Intronic
1045498101 8:102725460-102725482 CAGGGAAGCAGTGGCAGTCCTGG + Intergenic
1046063729 8:109172353-109172375 TGGGGAAACTGAGGCAGAGACGG - Intergenic
1047755621 8:127916125-127916147 TAGGGAAACTGAGGTACTGAGGG - Intergenic
1048323482 8:133420741-133420763 TAGGCAAGCTGAGGAATTGGAGG - Intergenic
1048474816 8:134733612-134733634 TAGGGAAACTGAGGCTGAGAAGG + Intergenic
1048757726 8:137756594-137756616 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1049211979 8:141391182-141391204 CAGGGAAGTGGAGGCAGGGCTGG + Intergenic
1049357401 8:142195599-142195621 TAGAGAAGCAGGGGCAGAGCAGG - Intergenic
1049401572 8:142429948-142429970 GCGGGACGCTGAGGCAGTGTAGG - Intergenic
1049478212 8:142806653-142806675 TGGGGAAACTGAGGCACTGGAGG + Intergenic
1050975224 9:11928963-11928985 TGGGGAGGCTTGGGCAGTGCAGG + Intergenic
1051099992 9:13510290-13510312 AATGGAAACTGAGGCAGTGATGG + Intergenic
1051808886 9:21028282-21028304 GAGGTTTGCTGAGGCAGTGCAGG - Intronic
1051916686 9:22217110-22217132 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1052240646 9:26269062-26269084 TCGGGAGGCTGAGGCAGAACAGG - Intergenic
1052667062 9:31508368-31508390 TAGGGCAGCTAAAGGAGTGCTGG - Intergenic
1052944855 9:34160150-34160172 TTGGGAGGTTGAGGCAGGGCAGG - Intergenic
1053155456 9:35775295-35775317 AAGGGAAGGTGAGGCAATGCAGG + Intergenic
1053273136 9:36763579-36763601 TAGGGAAACGGAGGCAGAGAGGG + Intergenic
1053317990 9:37068847-37068869 TAGGGAGGCTAAGGAAGTGGGGG + Intergenic
1055402953 9:75943917-75943939 TTGGGAAGCTGAGGCAAGGGAGG + Intronic
1055820188 9:80252985-80253007 TAAGGAAGGTGAGGCAGAGAGGG + Intergenic
1056280871 9:85040259-85040281 TGAGGAAGCTGAGGCAGAGAAGG + Intergenic
1056954770 9:91073207-91073229 TAGAGGAGCTGAGGCTGGGCGGG - Intergenic
1057231610 9:93324771-93324793 TGGGGAAGCTCAGGCGGAGCTGG + Intronic
1058491998 9:105512293-105512315 TAGAGAAACTGAGGCCGTGATGG - Intronic
1058711322 9:107681878-107681900 AAGAGAAGCTGAGGCTGGGCTGG + Intergenic
1059000781 9:110346647-110346669 TTGGGATGCTGAGGCTGTGGAGG + Intergenic
1059320658 9:113465878-113465900 CAGGGAAACAGAGCCAGTGCAGG - Intronic
1059366420 9:113789906-113789928 TAGGGATGCTGTGGCAGGGCTGG + Intergenic
1059754132 9:117276528-117276550 AAGGAAAGCTGAGACAGGGCAGG + Intronic
1060323197 9:122585391-122585413 TAGGGAAGCTGAGGCTTCCCTGG - Intergenic
1060629581 9:125143487-125143509 TCGGGAAGCTGAGGCGGCGGAGG + Exonic
1060896749 9:127223828-127223850 CTGGGAAACTGAGGCAGTCCGGG - Intergenic
1061163389 9:128909075-128909097 TAAGGCAGGTGAGGCGGTGCAGG - Exonic
1061883720 9:133580414-133580436 GAGGCCAGCTGAGGCAGAGCAGG - Intronic
1062160806 9:135078692-135078714 TGGGGAAGGTGGGGCAGGGCAGG + Intronic
1062245017 9:135561743-135561765 GAGGGATGCTGAGGCAGTGTGGG - Exonic
1062249694 9:135587943-135587965 GAGGGATGCTGAGGTAGTGTGGG - Intergenic
1062415799 9:136448907-136448929 TTGGGAAGGTGAGACAGTTCTGG + Intronic
1062443489 9:136583802-136583824 TGGGGAGGCAGGGGCAGTGCCGG + Intergenic
1062550553 9:137084279-137084301 TAGGGAGGCTGAGGCTGGCCTGG - Exonic
1062746826 9:138218332-138218354 GAGGGAATCTGAGGCTGTGTGGG + Intergenic
1187506606 X:19883513-19883535 CAGGGAATCGGAGGCAGTGGGGG - Intronic
1187610654 X:20939479-20939501 CAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1187965764 X:24609847-24609869 TTGGGAGGCTGAGGCAGGGGTGG + Intronic
1188750057 X:33893860-33893882 TTTGGCAGCTAAGGCAGTGCTGG - Intergenic
1188823682 X:34804101-34804123 TAGTGAAGTTGAGGCAAGGCTGG - Intergenic
1189185533 X:39051785-39051807 TAGGGAATCAGAGGCAGTGTAGG + Intergenic
1189406890 X:40733342-40733364 TTGGGAGGCTGAGGCAGGGGAGG - Intronic
1189703421 X:43735506-43735528 CAGGGAAGCTGACTCAGAGCTGG + Intronic
1190064334 X:47229795-47229817 TGGGGAGGGTGAGGCAGGGCAGG + Exonic
1190919626 X:54839760-54839782 TAGGGTGGCTAAGGGAGTGCTGG - Intergenic
1191170933 X:57446388-57446410 TAGGGAAGTGTAGGCAGAGCAGG - Intronic
1191252887 X:58267817-58267839 GGGGGACGTTGAGGCAGTGCAGG - Intergenic
1191254659 X:58274550-58274572 GAGGGAGGTTGAGGCAGGGCAGG - Intergenic
1191717914 X:64205701-64205723 TGGGGAAGGGGAGTCAGTGCTGG - Exonic
1191897239 X:66006077-66006099 TAGGGAACCAGAGGAAGTGGGGG - Intergenic
1191984291 X:66961812-66961834 TGGGGCAGCTAAGGTAGTGCTGG - Intergenic
1192191887 X:68996079-68996101 TGGAGAAGCTGGGGCAGGGCGGG + Intergenic
1193175102 X:78383770-78383792 TGGGGAAGCCAAGGGAGTGCTGG + Intergenic
1194023502 X:88723347-88723369 TGGGGAGGCTTAGGAAGTGCTGG + Intergenic
1194352168 X:92834399-92834421 TGGGGCAGCTGAGGGAGTGCCGG + Intergenic
1194393262 X:93347028-93347050 AAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1194522144 X:94932041-94932063 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1194831756 X:98631860-98631882 CAGGGCAGCTAAGGAAGTGCTGG + Intergenic
1195807912 X:108796143-108796165 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1195825004 X:108990221-108990243 TGTGGCAGCTGAGGGAGTGCAGG - Intergenic
1196007636 X:110852795-110852817 TAGGGAAGTAGAGGGAGTGTGGG + Intergenic
1196035484 X:111139240-111139262 TTGGGCAGCTGGGCCAGTGCTGG + Intronic
1196302419 X:114062662-114062684 TTGGGAAGCCGAGGCAGGTCAGG - Intergenic
1196753699 X:119139613-119139635 TAGGGAAACTGATGAAGAGCAGG - Intronic
1197476660 X:126933478-126933500 TGGGGAAGCCAAGGGAGTGCTGG - Intergenic
1197747244 X:129939883-129939905 TAGGGGAACTGAGGCACTGAGGG + Intergenic
1199115279 X:143985068-143985090 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1199210660 X:145206232-145206254 TGGGGTGGCTAAGGCAGTGCTGG + Intergenic
1199219848 X:145305572-145305594 AAGTGGAGCTGAGCCAGTGCAGG + Intergenic
1199236341 X:145498450-145498472 TAGGGTGGCTAAGGGAGTGCTGG + Intergenic
1199849512 X:151715469-151715491 TAGGGAAGCTGAGGGAGAACTGG + Intergenic
1199908393 X:152259397-152259419 CAGGGCAGCTAAGGGAGTGCTGG + Intronic
1200389309 X:155928028-155928050 TTGGGAGGCTGAGGCAAGGCAGG - Intronic
1200555490 Y:4631761-4631783 TGGGGAAGGTAAGGGAGTGCTGG - Intergenic
1200660480 Y:5951137-5951159 TGGGGCAGCTGAGGGAGTGCCGG + Intergenic
1201260923 Y:12158505-12158527 CAGGGAGGCTCAGGCTGTGCAGG + Intergenic
1201764912 Y:17567142-17567164 AGGGGAAGATGAGGCAGTCCGGG - Intergenic
1201836640 Y:18338847-18338869 AGGGGAAGATGAGGCAGTCCGGG + Intergenic
1202370228 Y:24191210-24191232 AAATGAAGCTGAGGCAGTACTGG + Intergenic
1202500556 Y:25478907-25478929 AAATGAAGCTGAGGCAGTACTGG - Intergenic