ID: 911181494

View in Genome Browser
Species Human (GRCh38)
Location 1:94864451-94864473
Sequence CACCCTAAAGGGTTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911181488_911181494 17 Left 911181488 1:94864411-94864433 CCGCAATTAAAATTCTGAAAGTG 0: 1
1: 0
2: 2
3: 29
4: 434
Right 911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911181494 Original CRISPR CACCCTAAAGGGTTGGTGGA TGG Intronic
902252415 1:15163032-15163054 CACACTAAAAAGTTGGTGGGTGG + Intronic
902716399 1:18275817-18275839 CACCCAAAAGCTTGGGTGGAGGG - Intronic
903812286 1:26041451-26041473 CACCCTTAGGGGTAGGGGGAAGG + Intronic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
905554861 1:38873942-38873964 CACCCTACAGGGGTGTTGTAAGG - Exonic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
907303462 1:53501961-53501983 CACCCTAGAAGGGTGGAGGAAGG + Intergenic
907958719 1:59257121-59257143 CACCCTTAAGGGTGGCAGGATGG + Intergenic
909177211 1:72376509-72376531 CATCCAAATGGATTGGTGGAGGG + Intergenic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
913353861 1:117896186-117896208 TACCTTATAGGGTTGATGGAGGG - Intronic
917125891 1:171686995-171687017 CACCTTGAAGGGTTGAGGGAAGG - Intergenic
919802085 1:201360075-201360097 CACCCTGCAGGGGTGGTGCATGG - Intronic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
921127806 1:212193478-212193500 CAGCCTAAAGTGTTTGTAGATGG - Intergenic
922181824 1:223241896-223241918 CACCGTAAAGGGGAGGTGGTAGG - Intronic
923492592 1:234497600-234497622 AACCCTGAAGGGTGGGTGGGTGG + Intergenic
1062888591 10:1038629-1038651 CCCCCTAAGGGGCAGGTGGAGGG + Intergenic
1065258805 10:23903151-23903173 AAACCTAAAGGGATGGAGGAGGG - Intronic
1067931637 10:50567989-50568011 CACCTTTAAGGTTTGGGGGAGGG + Intronic
1068082814 10:52340761-52340783 CATCTTCAAGGGTTTGTGGATGG - Intergenic
1070935930 10:80295221-80295243 CTCCCTGAAGGATTGGTGCAAGG + Intergenic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1072632422 10:97155454-97155476 TACCCCCAAGGGCTGGTGGAAGG + Intronic
1075088615 10:119430508-119430530 CAACCTAAAGGGTTGGCCCACGG + Intronic
1076885425 10:133260017-133260039 GACCCTTAAGGGATGCTGGATGG - Intergenic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1079492508 11:21004998-21005020 CACCCTAAATGGTTTTTGGATGG - Intronic
1079968260 11:27005164-27005186 CTTCCTAAAGGGTTGTTGCAAGG - Intergenic
1086500763 11:87451095-87451117 CACCCTCAAAGGGTGGTGGCAGG - Intergenic
1086855054 11:91856048-91856070 CACCCTGAAAGGTCAGTGGATGG + Intergenic
1089092797 11:115892278-115892300 CACCTTACAGGGTTGCTGCAGGG + Intergenic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1091321164 11:134652975-134652997 CACTCTCAAGGGTTGTGGGAAGG - Intergenic
1092766025 12:11853792-11853814 CACCGTAAAGGTGTGGTGGAAGG + Intronic
1094473817 12:30826094-30826116 CACCTTACAGGGTTGGTGTGAGG + Intergenic
1096709754 12:53446694-53446716 CACTTTAAAGGGTCTGTGGAAGG - Intergenic
1098223713 12:68298547-68298569 CACCCTAAAGTGTTCCAGGAAGG - Intronic
1100098629 12:91075294-91075316 GACCCTAAAGTGTTGGTACAAGG + Intergenic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1103515783 12:121507377-121507399 TACTCCAAAGGGTTGTTGGAAGG + Intronic
1104500588 12:129281940-129281962 CTCCCTGTGGGGTTGGTGGAGGG + Intronic
1108921514 13:55680443-55680465 CACTCTATTGGGTTAGTGGAAGG - Intergenic
1110127876 13:71969859-71969881 AACCCAAAAGACTTGGTGGAAGG - Intergenic
1116918575 14:50548943-50548965 CCCCATAAAAGGTGGGTGGAAGG + Intronic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1121689562 14:95866672-95866694 CACCTTTCAGGTTTGGTGGAGGG + Intergenic
1125711280 15:41788858-41788880 CACGCTGATGGGTTGGAGGAGGG + Intronic
1128218002 15:65947504-65947526 CACCCTACAGGGTTGTTGTGAGG + Intronic
1128377868 15:67090099-67090121 CACCCTAAGGGGGTGGTGACAGG + Intronic
1128666074 15:69539271-69539293 CCCCCAAAAGTGTTGTTGGAAGG + Intergenic
1129944164 15:79524660-79524682 CTCCCCAGAGGGATGGTGGAGGG + Intergenic
1130230272 15:82091618-82091640 CCCCCAAAAGGGGTGGGGGAGGG + Intergenic
1131344228 15:91631142-91631164 CAGCCCAGAGGGTGGGTGGATGG + Intergenic
1131771000 15:95737142-95737164 AGCCCAAAAGGATTGGTGGAGGG + Intergenic
1133841764 16:9416524-9416546 CTCCAGAAAGGATTGGTGGAAGG + Intergenic
1134636491 16:15795784-15795806 CACCCCATTGGGTTGTTGGAAGG - Intronic
1135601625 16:23788619-23788641 CACCCTAGAAGTTTGGTGAAAGG - Intergenic
1136146228 16:28318023-28318045 CACACTTAATGGGTGGTGGAAGG + Intronic
1136395221 16:29988753-29988775 TACCCTAGTGGGTTGGGGGACGG + Intronic
1138036327 16:53610509-53610531 CACCATAGAGGGTTGGTGTGAGG - Intronic
1140905811 16:79408098-79408120 AAACCTAAAGGCGTGGTGGAGGG + Intergenic
1141055261 16:80807827-80807849 AAGCCTAAAGGAATGGTGGAAGG + Intergenic
1143275552 17:5707118-5707140 CACCTGAGAGGGTTGATGGAAGG - Intergenic
1144210121 17:13007538-13007560 CACCCAAACGGGTTTGAGGATGG + Intronic
1144261130 17:13521960-13521982 CACCCTAGAGGGGGAGTGGAGGG - Intronic
1145207865 17:20994331-20994353 CTCCCTGCAGGGTAGGTGGACGG + Intergenic
1148323205 17:46769747-46769769 CTCCCTGAAGGGTTTGGGGAGGG + Intronic
1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG + Intronic
1152546614 17:81003591-81003613 AACCCTAAAGGGCTGGCGGGAGG - Intronic
1153532965 18:6068619-6068641 CACCCTAAATTGTTCCTGGAAGG + Intronic
1158630415 18:59109267-59109289 GACCCTAAAGGGTGGGAGGATGG + Intergenic
1164056150 19:21623652-21623674 CACCCTAAAGGGTTGCAACAGGG + Intergenic
1165886419 19:39082299-39082321 CACCTTATAGGGTTGTTGCAAGG - Intergenic
1166360724 19:42251933-42251955 CACCCTGAGGGGCTGGTGGAAGG - Intronic
925431825 2:3801354-3801376 CACCCTGAAGGGCTGCTGGGAGG + Intronic
926809357 2:16742627-16742649 CAGCCTGTAGGGTGGGTGGATGG + Intergenic
927074693 2:19566023-19566045 CATCTTACATGGTTGGTGGAAGG - Intergenic
928144239 2:28757503-28757525 CAACCTAAAGGTTAGGTGGTTGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933805919 2:85997968-85997990 CACCTTATAGGGTTGCTGTAAGG + Intergenic
934737581 2:96697752-96697774 CACCCTCAAGGTTTGAAGGAGGG + Intergenic
936239938 2:110778652-110778674 TACCTTAAAGGGTTGATGGGAGG + Intronic
936856623 2:116966060-116966082 CACCCTAAAGGCAGGGTGGAAGG - Intergenic
937344886 2:121119386-121119408 AACCATCAAGGGTTAGTGGAAGG - Intergenic
938242430 2:129753640-129753662 CACCATATAGGGTTGTTGTAGGG + Intergenic
941866199 2:170337174-170337196 GACCCAAAAGAGTAGGTGGAGGG + Intronic
942737840 2:179136329-179136351 CTCCATAAAGAGTTAGTGGACGG - Intronic
946507140 2:220313903-220313925 CCCCATAAAATGTTGGTGGAGGG - Intergenic
948247448 2:236498656-236498678 CACCTTAAGGCTTTGGTGGAAGG - Intronic
948267625 2:236647110-236647132 CATCCTGATGGGTGGGTGGAGGG - Intergenic
948822943 2:240559251-240559273 CACCCTTTACGGTTGGAGGATGG - Intronic
1169202356 20:3717982-3718004 CACCCCAAAGGGTTGGTAGCTGG + Intergenic
1170832560 20:19855640-19855662 CTCCTTAAATGGTTGGTTGATGG - Intergenic
1172948032 20:38703574-38703596 CACCCTATATGGTGGGTTGATGG + Intergenic
1174460448 20:50678527-50678549 TACCTTAAGGGGTGGGTGGAGGG + Intronic
1175134413 20:56812159-56812181 CACCCCAAGGGGTTGCTGAAAGG + Intergenic
1176334489 21:5583370-5583392 GACAGTACAGGGTTGGTGGAAGG + Intergenic
1176393268 21:6237578-6237600 GACAGTACAGGGTTGGTGGAAGG - Intergenic
1176468151 21:7078596-7078618 GACAGTACAGGGTTGGTGGAAGG + Intronic
1176491712 21:7460374-7460396 GACAGTACAGGGTTGGTGGAAGG + Intergenic
1176508930 21:7678009-7678031 GACAGTACAGGGTTGGTGGAAGG - Intergenic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG + Exonic
1181625123 22:24118053-24118075 CACCTCAAAGGGTAGGGGGAGGG + Intronic
1182076346 22:27498039-27498061 CACCACATAGGGTTGGCGGAAGG + Intergenic
1182787822 22:32922370-32922392 CACCCTATAGGGTTGTCGAAAGG + Intronic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
950525066 3:13518652-13518674 CCCCCCCAAGGGTTGGTGGCAGG + Intergenic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
952830333 3:37559400-37559422 TACCCCAAAGGGTTGGTGTGAGG + Intronic
957540530 3:81563592-81563614 CACCTTTAAGGGCTGGTGCAGGG - Intronic
959744127 3:109756941-109756963 TACCCTAAAGGGTTGTTGTGAGG + Intergenic
960796146 3:121490640-121490662 CACCAGAAAGGGGTGGTGGGTGG + Intronic
961763321 3:129188105-129188127 CTCCCTAAAGTGATGGTGTAGGG + Intergenic
962462289 3:135625532-135625554 CACCAAAAAGGTTGGGTGGAGGG - Intergenic
964684576 3:159381486-159381508 CACCATCAAGGGTTTTTGGATGG - Intronic
971212758 4:24635652-24635674 CTCACTAAAGTGTTGATGGAGGG + Intergenic
976940505 4:90696728-90696750 CACTCTTAAAGGTTGTTGGAAGG - Intronic
979620603 4:122794790-122794812 CACCCTTATGCCTTGGTGGATGG + Intergenic
980469109 4:133228138-133228160 AACCTGAAAAGGTTGGTGGAAGG - Intergenic
982657369 4:158166862-158166884 CCCCCTAAAGGATTTGTTGAGGG + Intronic
987391992 5:17385286-17385308 CACCCTAGATGGTTGTTGGCAGG - Intergenic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
990051262 5:51504506-51504528 AACCCTAAATGGTTGTTGGTCGG - Intergenic
991146529 5:63312543-63312565 CAGCCTAAGGGGTATGTGGAAGG + Intergenic
991200513 5:63986470-63986492 CTCCCTAAAGGCTGGGAGGAAGG + Intergenic
992002633 5:72450718-72450740 GAACCTAAAGGCTTGGTGGAAGG - Intronic
994569605 5:101498881-101498903 GACCTTAAAGGGTGGGTGCAAGG - Intergenic
995662627 5:114501795-114501817 CACTCTGAAGGGATGGTAGATGG - Intergenic
998387105 5:141763703-141763725 CAGCCTCCCGGGTTGGTGGAGGG - Intergenic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1003448299 6:6205493-6205515 CTCCCTAAAGACTTTGTGGATGG - Intronic
1006152639 6:31997523-31997545 CACCCTACAGGGTCGTTAGAAGG + Intronic
1006158945 6:32030260-32030282 CACCCTACAGGGTCGTTAGAAGG + Intronic
1007745922 6:44042869-44042891 CGCCTTGAAGGGCTGGTGGAAGG - Intergenic
1008025273 6:46628961-46628983 TACCTTAAAGGGTTGTTGTAAGG - Intronic
1008044596 6:46838795-46838817 CACCTCAAAGGGTTGTTGCAGGG + Intronic
1008127872 6:47689288-47689310 CACCCCTCAGGGTTGGAGGACGG - Intronic
1009469697 6:64017219-64017241 CACCCTGTAGTGTTGGTGGCAGG + Intronic
1009614850 6:65990987-65991009 CACCCTGAAGTGTTCGAGGAGGG - Intergenic
1012963853 6:105651830-105651852 CACCCTCAGGTGTTGGTGTATGG - Intergenic
1017077220 6:150630432-150630454 CAGCCCACAGGGTTTGTGGATGG + Intronic
1017152131 6:151290280-151290302 CACCCTACAGGGAGGGTGGGTGG + Intronic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG + Intronic
1018433660 6:163742846-163742868 CTTCCTAAGGGGTTGGAGGATGG + Intergenic
1018645119 6:165941179-165941201 CACCCCATAGGGTTGTTGAAAGG + Intronic
1018909862 6:168095715-168095737 CACCTTCCAGGGTTTGTGGAGGG - Intergenic
1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG + Intergenic
1023661457 7:42475316-42475338 CACACCAAAGGGTTGGTGAAAGG + Intergenic
1024177608 7:46856970-46856992 CACCTTAAAGGGATGTTGTAAGG + Intergenic
1026760231 7:73121186-73121208 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027036573 7:74930007-74930029 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG + Intergenic
1029393291 7:100289446-100289468 CACTCTATAGAGTTGTTGGAAGG + Intergenic
1033358710 7:140622684-140622706 CCCCCTAGAGGGTTGGTGGACGG - Intronic
1038900368 8:31835616-31835638 CAGCCTAAGGGGTTTGTGAAAGG - Intronic
1042499870 8:69497069-69497091 TTTCCTAAAGGGTTGTTGGAAGG - Intronic
1044259281 8:90098547-90098569 CACCCTAGAGGGCTGCAGGAAGG - Intergenic
1045345150 8:101287493-101287515 CACCAAAGAGGGTGGGTGGAGGG + Intergenic
1047710742 8:127549931-127549953 CACCCGAAAGGGTTGTTGTGTGG + Intergenic
1049150820 8:141034463-141034485 CACCCTCAAGGGCAGGTTGAGGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057417201 9:94875149-94875171 CACCCTAAAGGGTAGCAGAAAGG - Intronic
1057887192 9:98838797-98838819 TACCCTGCAGGGTTGCTGGAAGG - Intronic
1203427143 Un_GL000195v1:51548-51570 GACATTACAGGGTTGGTGGAAGG - Intergenic
1186057186 X:5662264-5662286 CACCCTAAAGAGGTGGTTGCTGG - Intergenic
1187262819 X:17702927-17702949 CACCTTAAAGGGATGGGGAAGGG - Intronic
1187884827 X:23879683-23879705 TACTCTAAAGGGTGGGTGAAGGG + Intronic
1194666283 X:96681113-96681135 CACACAAATAGGTTGGTGGATGG - Intergenic
1195455977 X:105070275-105070297 AAGCCTGAAGGGTTGGGGGAAGG - Intronic
1196654137 X:118199247-118199269 GACCCTAAAGGGCAGGTAGATGG - Intergenic
1198410044 X:136357523-136357545 CACCCTACAGGGTTGGTGTGAGG + Intronic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199099752 X:143785186-143785208 CACCCACCAGGGTGGGTGGAGGG + Intergenic
1199511126 X:148623916-148623938 AAGCCTACAGGGTTGGTAGAAGG + Intronic
1201592270 Y:15628318-15628340 CTCCCTAAAGAGTTGTTGAATGG + Intergenic