ID: 911182517

View in Genome Browser
Species Human (GRCh38)
Location 1:94873968-94873990
Sequence AATCCTCCACCCCTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911182513_911182517 14 Left 911182513 1:94873931-94873953 CCAGACAGCCATTCTTTCAGTGA 0: 1
1: 0
2: 0
3: 16
4: 174
Right 911182517 1:94873968-94873990 AATCCTCCACCCCTGCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 136
911182515_911182517 6 Left 911182515 1:94873939-94873961 CCATTCTTTCAGTGACAGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 911182517 1:94873968-94873990 AATCCTCCACCCCTGCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911182517 Original CRISPR AATCCTCCACCCCTGCTGAC TGG Intronic
900316606 1:2060294-2060316 CTTCCCCCACCCCTGCTGCCAGG + Intronic
900673605 1:3870596-3870618 AATCCTTCATCCCTGATGGCAGG + Intronic
900826976 1:4934829-4934851 AATCCTCCTCCACTGCTGATGGG - Intergenic
901908579 1:12436145-12436167 AGTCCTCCTCCCCTGCTGGATGG - Intronic
911182517 1:94873968-94873990 AATCCTCCACCCCTGCTGACTGG + Intronic
912861803 1:113219956-113219978 AATCACCCTCTCCTGCTGACTGG - Intergenic
914314313 1:146495506-146495528 TATCCTTCACCTCAGCTGACTGG - Intergenic
914500035 1:148237875-148237897 TATCCTTCACCTCAGCTGACTGG + Intergenic
917259471 1:173151117-173151139 AATCCTACAACCATGTTGACTGG + Intergenic
917515214 1:175701470-175701492 GCTCCTCAACCCCAGCTGACTGG + Intronic
917979514 1:180260322-180260344 AATCCTACACCCTGGCTGTCTGG - Intronic
919397396 1:197068570-197068592 AATCCTGCTCCCCTACTGCCTGG + Intergenic
919817563 1:201451090-201451112 AATCCCCCGCCCCTGCCCACAGG - Intergenic
919918510 1:202153919-202153941 CATCCTCCACCCCTACTGGATGG + Intronic
920065972 1:203269933-203269955 AACCCTCCATCCCTGCCCACCGG - Intronic
922039697 1:221884719-221884741 AAACCTTCACCCCTGCTGAGTGG + Intergenic
922414607 1:225409412-225409434 TCTCCCCCACCCCTGCTGGCTGG - Intronic
1063196317 10:3747117-3747139 GATCCTCCACCTCTGTAGACAGG - Intergenic
1067686743 10:48470390-48470412 CCTCCCCCACCCCTGCTGATGGG - Intronic
1070330735 10:75415289-75415311 ACACCTCCACCCCCGCTGAAGGG - Intergenic
1070560086 10:77559598-77559620 GATCCTCCATTCCTGCTGAGAGG + Intronic
1072289801 10:93953396-93953418 ATTCCTCATCCCCTGCTGAGGGG + Intronic
1074198626 10:111210998-111211020 AATCCTCCAGTCCTACTAACAGG - Intergenic
1080441782 11:32301146-32301168 AACCCTCCTACACTGCTGACGGG + Intergenic
1083275530 11:61594996-61595018 AATTCTCCTCCCGTGCTCACTGG + Intergenic
1083476560 11:62919221-62919243 AAACTTCCACCCCTGATGTCTGG + Intronic
1084067935 11:66716042-66716064 CATCCCCCACCCCTGCCAACTGG - Intronic
1085913413 11:80855692-80855714 AATTCTCCACCCCTGCCTACAGG + Intergenic
1086045531 11:82527133-82527155 AAGCCTCCATCTCTCCTGACTGG - Intergenic
1088643703 11:111898459-111898481 AATCCTCCACAGCAGCTTACAGG - Intergenic
1088736823 11:112734557-112734579 AATCCTGCACCACTGCTGCTTGG - Intergenic
1089308571 11:117542890-117542912 TTTCCTCCAACCCTGCTGCCAGG + Intronic
1090548343 11:127790800-127790822 AAGCCTCCAGCCCTGCTCCCGGG - Intergenic
1093383371 12:18521603-18521625 AACCCCCCACCCCTCCTGGCTGG - Intronic
1093898100 12:24598974-24598996 TAGCCTCCACCCCCGCCGACAGG + Intergenic
1095838052 12:46660106-46660128 GATCCACCTCCTCTGCTGACAGG + Intergenic
1098620637 12:72593664-72593686 CCTCCTCCCACCCTGCTGACAGG + Intronic
1102173890 12:110862052-110862074 CATCACCCACCCCTGCTGTCTGG + Intronic
1104608970 12:130212569-130212591 ACAGCTCCACACCTGCTGACTGG + Intergenic
1104650274 12:130526085-130526107 AACCCCCCACCCCTGCCAACTGG - Intronic
1105838673 13:24233842-24233864 TCTCCTCCAGCACTGCTGACAGG + Intronic
1111650500 13:91084920-91084942 AATCCTCCTACCCTGCTTGCGGG + Intergenic
1112206798 13:97332273-97332295 CCTCCTCCACCCCAGCTGATGGG + Intronic
1125715494 15:41817596-41817618 CATGCTCCACCCCTGCAGTCTGG + Exonic
1127469296 15:59276131-59276153 CTTCCTCTACCCCTGCTGAGAGG + Intronic
1129252659 15:74317499-74317521 AAATCTCCACCCCTGCTGCTGGG - Intronic
1129275403 15:74442151-74442173 AGTCCTCAACCCCTGCTATCTGG + Intergenic
1131183387 15:90255669-90255691 AATCCTCCTCCACTGCTTCCTGG + Intronic
1132235648 15:100218600-100218622 AATCTTCCTACACTGCTGACAGG + Intronic
1135413186 16:22250418-22250440 ATTCCTCCACCCCAGCTGAGGGG - Intronic
1137476783 16:48816366-48816388 AATCTTTGACCACTGCTGACTGG - Intergenic
1138198202 16:55069869-55069891 TATTCTCCACCCCTCCTGAAGGG + Intergenic
1139341908 16:66272926-66272948 AATCCTTCACTCTTGCTGTCTGG - Intergenic
1139713343 16:68793053-68793075 GCTCCTGCACCCCTGTTGACAGG - Intronic
1140182175 16:72730835-72730857 CATCCCCCACCCCTGCCAACAGG + Intergenic
1142614177 17:1125398-1125420 AATCCTCCACCAGAGCTGCCAGG + Intronic
1146953976 17:36925444-36925466 ACTCCTCCACCCCTGCTCTGGGG - Intergenic
1148053202 17:44779356-44779378 ATTCCCCCACCCCTGCTGCCAGG + Intronic
1148872329 17:50665997-50666019 AGTCCTCACCCCCTGCGGACTGG + Intronic
1149991561 17:61386428-61386450 ATTTCTCCACCCACGCTGACTGG - Intronic
1157442599 18:47722086-47722108 AATCCTTCACCCCACCTGCCGGG + Intergenic
1157611226 18:48957289-48957311 CAGCCTCCACCCTTGCTGTCTGG - Intergenic
1160897713 19:1410434-1410456 AACCCTCTAACCCTCCTGACAGG - Intronic
1162696718 19:12482419-12482441 ATTCCCTCACCCCTGGTGACAGG + Intronic
1162735630 19:12745533-12745555 CAGCCCCCACCCCTGCTGGCTGG - Intronic
1163232914 19:16016077-16016099 AATGCTGGATCCCTGCTGACAGG - Intergenic
1163773658 19:19205563-19205585 CAGCCCCCACCCCTGCTGCCTGG - Intergenic
928313735 2:30231108-30231130 ACTCCTCCACCCCAGCCGCCCGG - Intergenic
928350381 2:30547492-30547514 AAACAACCATCCCTGCTGACAGG - Intronic
928378912 2:30801744-30801766 CAGTCTCCATCCCTGCTGACTGG - Intronic
931260339 2:60612546-60612568 AATCCACCTCCACTTCTGACTGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
932546711 2:72719139-72719161 ATTCCTCCACCCCTGGTCATTGG + Intronic
933705377 2:85285658-85285680 CATCCTCCACCAGGGCTGACTGG - Intronic
934781521 2:96972311-96972333 CAGCCTGCACCCCTGCAGACAGG + Exonic
937014963 2:118596817-118596839 GAGCCACCACCCCTGCTGTCTGG - Intergenic
937294190 2:120799849-120799871 CATTCTCCTCACCTGCTGACAGG - Intronic
942470430 2:176254192-176254214 ACCCCTCCACCCCTGCTACCTGG - Intergenic
946605765 2:221402441-221402463 ACTCCTCCCTCCCTCCTGACAGG + Intergenic
1182313621 22:29427240-29427262 AAGCCACCTCACCTGCTGACAGG + Intergenic
1183615198 22:38940159-38940181 AAGCCTCCACCCCATCTGGCCGG - Intergenic
1185032852 22:48453825-48453847 GATCCACCACCCCTTCTGCCGGG - Intergenic
1185329965 22:50248076-50248098 AGGCCTCCACCTCTGCTGCCTGG - Exonic
951732305 3:25823801-25823823 CATCCTCCACCCCTGCTTCCTGG - Intergenic
952304843 3:32136536-32136558 AGTCCTCCACACCTCCTGAAGGG + Intronic
952850421 3:37723917-37723939 AATTCTCTGGCCCTGCTGACAGG + Intronic
954411371 3:50372687-50372709 AGGCCTCCAGCCCTGCTGAGTGG + Intronic
965284432 3:166800060-166800082 AATTCTCCACCACTACTGGCAGG - Intergenic
967191751 3:186990931-186990953 CCTCCTCCACCCCTGCTTCCAGG + Intronic
968528071 4:1074593-1074615 AGTCCTCCACTCCTACTCACTGG + Intronic
968734680 4:2289353-2289375 CTTACTCCACCCCTGCTGAGGGG - Intronic
969312168 4:6360107-6360129 AATAGTCCACCCCTGCAGGCAGG + Intronic
969638997 4:8385691-8385713 AATCCTCCACCCTTCCTCACAGG + Intronic
975610817 4:76200991-76201013 GATACTCCACCCCTGCTCAAAGG + Intronic
977814174 4:101394756-101394778 AATCCTCCACCCCTGTTCTTTGG - Intergenic
981361185 4:143847509-143847531 AATCCTCAGCCCCTGCTAAAAGG - Intergenic
981371924 4:143968505-143968527 AATCCTCAGCCCCTGCTAAAAGG - Intergenic
981381016 4:144071705-144071727 AATCCTCAGCCCCTGCTAAAAGG - Intergenic
981723142 4:147821344-147821366 AATCCTCCAGCCCTCCTTGCAGG - Intronic
985641130 5:1063964-1063986 CTTCCTCCACACCTGCAGACAGG + Exonic
992767265 5:80012865-80012887 AAATCTCTACCCCTACTGACTGG + Intronic
997079137 5:130717352-130717374 CATCCTCCTCCCCTCCTGAGAGG - Intergenic
998536725 5:142939703-142939725 AATCCTACACCACTGCTTATTGG + Intronic
1001117659 5:168953058-168953080 AATCCTCCACCCTTGATATCTGG - Intronic
1002782990 6:381009-381031 TTCCCTCCACCCCTCCTGACTGG - Intergenic
1003017533 6:2480017-2480039 ACTCCTCCACTCCTGCCCACAGG + Intergenic
1003567986 6:7236571-7236593 GCTCCTCCACCCCTGCAGGCAGG - Intronic
1004158519 6:13192415-13192437 AATCCTACATCCCTGCTGATAGG - Intronic
1004754794 6:18600077-18600099 ATGCCTCCACCCTGGCTGACTGG + Intergenic
1004920735 6:20373088-20373110 AATCCTCCTCCCCTTCTCAGAGG + Intergenic
1006402649 6:33826775-33826797 AGTCCTCCACCCAGGCTGCCTGG + Intergenic
1006470567 6:34226500-34226522 TCTCCTCCACCCCTGCTCCCTGG - Intergenic
1013666376 6:112353412-112353434 CTTCCTGCACCCCTGCTGCCTGG + Intergenic
1017757707 6:157543704-157543726 CATCCTTCATCCCTGCTGCCTGG + Intronic
1018688443 6:166322296-166322318 TATCCTCCCGCCCTGCTGCCTGG - Intronic
1019215015 6:170437915-170437937 CCTCCTCCACCCTTGCTGGCTGG + Intergenic
1019429677 7:992893-992915 AATTCCCCACCCCTCCTGCCTGG + Intergenic
1021329335 7:19315858-19315880 AATCCTTCCCCACTGCAGACAGG + Intergenic
1021574978 7:22098769-22098791 AATCCCCCAGCCTTTCTGACAGG + Intergenic
1023794746 7:43782464-43782486 AATTATCCACCCTTCCTGACAGG - Intronic
1024594677 7:50922164-50922186 TCTCCTCCAACCCTTCTGACTGG + Intergenic
1028491435 7:91416496-91416518 AATAATCCACACCTGCTGGCAGG + Intergenic
1030317639 7:108132727-108132749 AATCCTCCACACTTCCTGTCAGG - Intergenic
1034427155 7:151020092-151020114 AATCCTCCCCACCTTCTGCCTGG + Intronic
1035451415 7:158979507-158979529 CCTCCTCCTCCCCTGCTGCCTGG - Intergenic
1036106091 8:5842073-5842095 AATCCTGGACCACAGCTGACAGG + Intergenic
1037506903 8:19539799-19539821 CCTCCTACACCCCTGCTGAGGGG + Intronic
1040637361 8:49290631-49290653 AAGCCCCCACCCCGGGTGACTGG + Intergenic
1041826641 8:62102203-62102225 AACACTTCACCCCTGCTGCCAGG - Intergenic
1043273105 8:78358569-78358591 AATCCTCTGTCCCTGCTGAAAGG - Intergenic
1048518803 8:135135388-135135410 AATCCTCCCACTCTGCTGCCTGG + Intergenic
1049383065 8:142326997-142327019 AACCCTCCAACACTGCTGGCGGG + Intronic
1049579674 8:143405574-143405596 AAGCCCCCTCCCCTGCTGTCAGG - Intergenic
1050890788 9:10821639-10821661 AATCTTCCACCCCTGGTCTCTGG - Intergenic
1051848088 9:21475718-21475740 AACCATCAACCCCGGCTGACTGG + Intergenic
1056383234 9:86074571-86074593 CAGCCTCCACCCCTGCACACTGG - Intronic
1057473349 9:95377702-95377724 AATTCTCCAGCCCTACTGATGGG - Intergenic
1059720220 9:116952699-116952721 CATCATCCACACCTGCTGTCAGG + Intronic
1061760444 9:132847550-132847572 CAGCCCCCACCCCTGCTGAGGGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062243406 9:135551548-135551570 ATGCGGCCACCCCTGCTGACCGG + Intergenic
1190360562 X:49644935-49644957 AGGCCTCCAGTCCTGCTGACCGG - Intergenic
1198656076 X:138914472-138914494 AATACCCCAACCCTGCTGTCTGG - Intronic
1200109893 X:153735379-153735401 AACCCTCCAACACTGCTGGCGGG - Intronic
1201145719 Y:11064419-11064441 ACCCCTCCTCCCCTGCTGTCTGG - Intergenic