ID: 911184124

View in Genome Browser
Species Human (GRCh38)
Location 1:94886464-94886486
Sequence ACAGACATGAGCATACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911184124_911184128 20 Left 911184124 1:94886464-94886486 CCTGCTGGTATGCTCATGTCTGT 0: 1
1: 0
2: 0
3: 19
4: 139
Right 911184128 1:94886507-94886529 GCTGCTGCCTCCTACCCTGCTGG 0: 1
1: 0
2: 9
3: 40
4: 470
911184124_911184126 -8 Left 911184124 1:94886464-94886486 CCTGCTGGTATGCTCATGTCTGT 0: 1
1: 0
2: 0
3: 19
4: 139
Right 911184126 1:94886479-94886501 ATGTCTGTGGCTCATGTTGCTGG No data
911184124_911184130 27 Left 911184124 1:94886464-94886486 CCTGCTGGTATGCTCATGTCTGT 0: 1
1: 0
2: 0
3: 19
4: 139
Right 911184130 1:94886514-94886536 CCTCCTACCCTGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911184124 Original CRISPR ACAGACATGAGCATACCAGC AGG (reversed) Intronic
903140713 1:21337616-21337638 ACAGTCATGACAATAACAGCAGG + Intronic
904457021 1:30653951-30653973 ACAGGCCTGAGCATACAGGCTGG - Intergenic
906586720 1:46984789-46984811 ACAGACATGAAGATAGCTGCAGG + Intergenic
911184124 1:94886464-94886486 ACAGACATGAGCATACCAGCAGG - Intronic
914692637 1:150044507-150044529 ACAGGCATGAGCCCACCACCTGG + Intergenic
914781291 1:150787667-150787689 ACAGACTTTTGCATACCAGGAGG - Intergenic
915801250 1:158795389-158795411 ACAGACATGGGCACAGAAGCTGG - Intergenic
919448872 1:197746113-197746135 ACAGGCATGAGCAAACATGCTGG - Intronic
921196573 1:212762990-212763012 ACAGACATGAGCAGAGGAGCTGG + Intronic
924164146 1:241264793-241264815 ACAGACATAAACACACCAACAGG + Intronic
924566958 1:245206956-245206978 TCAGACTTGATCATTCCAGCTGG - Intronic
1067114491 10:43424191-43424213 ACAGACATGAGCACCGCACCTGG + Intergenic
1068205309 10:53842521-53842543 ACAGGCATGAGCATCACATCTGG + Intronic
1069420865 10:68245192-68245214 ACAGACATGTGTATACCACCAGG - Intergenic
1070038837 10:72754738-72754760 ACAGGCATGAGCAGCCCAGGAGG + Intronic
1070466555 10:76729857-76729879 ACAGACATGTGCATTCCCTCTGG - Intergenic
1070935823 10:80294258-80294280 AGAAAGATGAGCATCCCAGCTGG + Intergenic
1072069919 10:91906243-91906265 ACAGAGGTGAGAATACCAGGAGG + Intergenic
1073762817 10:106648936-106648958 ACAGGCACCAGCATGCCAGCAGG + Intronic
1075952957 10:126497869-126497891 GCAGGCATGAGCAAACCACCAGG - Intronic
1077100862 11:821754-821776 ATAGCCATGAGCATGCCAGTGGG + Exonic
1078441663 11:11373246-11373268 ACAGCAATGAGCTTCCCAGCTGG - Intronic
1078959051 11:16241763-16241785 ACAGTCATGACCATCCCACCTGG + Intronic
1079113179 11:17618987-17619009 ACAGGCATGAGCCTACATGCCGG - Intronic
1080257953 11:30313469-30313491 GCAGCCATGAGAATCCCAGCTGG - Intergenic
1080635578 11:34120730-34120752 AAAGACATGAGCAGACCATATGG + Intronic
1086089367 11:82990068-82990090 ACAGGCATGAGACTAACAGCAGG - Intronic
1088165011 11:106924726-106924748 ACAGACATGAGCCACCAAGCTGG - Intronic
1088667314 11:112106280-112106302 ACAGACAAGAGAAAACCATCAGG + Intronic
1090096821 11:123750538-123750560 ACAGGTATGAGAATACCACCAGG - Intergenic
1090136119 11:124200877-124200899 ACAGGCACCAGCATGCCAGCAGG + Intergenic
1090321234 11:125845206-125845228 TCATACAGGAGCATTCCAGCTGG + Intergenic
1093386129 12:18556699-18556721 AAAGACATGAGGATAATAGCAGG - Intronic
1094586532 12:31782280-31782302 GCAGGCACCAGCATACCAGCAGG + Intergenic
1095234236 12:39777722-39777744 ACAGGCATCGGCATGCCAGCAGG + Intronic
1097768730 12:63555149-63555171 ACAGCCATGAGCATCGCACCAGG + Intergenic
1098869669 12:75802568-75802590 AAGGACATGAGGATAACAGCTGG + Intergenic
1099212523 12:79810283-79810305 ACAGAAATGAGCACACCATAAGG + Intronic
1099460046 12:82910758-82910780 ACAGACAGGGGCATACCAGAAGG - Intronic
1100991802 12:100259352-100259374 ATACACCTGAGCATGCCAGCAGG + Intronic
1103031432 12:117616770-117616792 AAAGAAATGAGCATATCAGAAGG - Intronic
1103962371 12:124617166-124617188 GCAGCCATGAGCAAACCAGGGGG - Intergenic
1115006501 14:28491933-28491955 ACAGACATTACCATTCCAACAGG + Intergenic
1120744671 14:88142755-88142777 ACAGGCACCAGCATCCCAGCAGG + Intergenic
1124161479 15:27274106-27274128 AGAGACATAAGCATTCCAGGAGG + Intronic
1126813958 15:52436582-52436604 ACAAACAAGAACATAACAGCAGG - Intronic
1133635845 16:7664585-7664607 ACAGACATGAGCATCTTAACAGG - Intronic
1134083553 16:11340981-11341003 ACAGTCATGAGCAGACAAGTGGG - Intronic
1135492437 16:22921228-22921250 ACACACATGTGCATACCAAAAGG - Intergenic
1140596692 16:76424455-76424477 AAAGACATAAGCATACAGGCTGG + Intronic
1141990803 16:87608452-87608474 ACAGCCATGAAGCTACCAGCGGG - Intronic
1142065311 16:88059070-88059092 ACGGACCTCAGCACACCAGCAGG - Intronic
1142065315 16:88059096-88059118 ACGGACCTCAGCACACCAGCAGG - Intronic
1142065319 16:88059122-88059144 ACGGACCTCAGCACACCAGCAGG - Intronic
1144362820 17:14511359-14511381 AAAGACCTCAGCATAGCAGCTGG + Intergenic
1155010854 18:21776391-21776413 ACATGCATGTGCATACCTGCAGG + Intronic
1155294900 18:24376148-24376170 CCAGACAAGAGAATAACAGCAGG - Intronic
1160015264 18:75135323-75135345 ACTGCCAAGTGCATACCAGCAGG + Intergenic
1162122743 19:8481841-8481863 ACAGACTTCAGTCTACCAGCAGG - Intronic
1166247604 19:41540154-41540176 ACAGGCACCAGCACACCAGCAGG + Intergenic
1167566194 19:50258795-50258817 ACAGACATCAGCTTCCCAGGAGG + Intronic
926215147 2:10901753-10901775 TCAGACAGGAGTAGACCAGCTGG + Intergenic
926314324 2:11698091-11698113 ACAGACACCAACATCCCAGCAGG - Intronic
928537942 2:32258205-32258227 ACAGACATCGGCACGCCAGCAGG - Intronic
929609531 2:43259932-43259954 ACAGGCATGATCATACCAGGTGG - Intronic
930793923 2:55367587-55367609 ACAGGCATGATCATACCATATGG + Intronic
933398808 2:81765544-81765566 ACAGACACCGGCATGCCAGCAGG + Intergenic
934577015 2:95409093-95409115 ACTGACATGAGCCTCCCAGTGGG - Intronic
935374528 2:102381094-102381116 ACAGGCATGAACTTAACAGCAGG + Intronic
937650288 2:124311896-124311918 ACAGATATGATCATACAAACTGG + Intronic
939757353 2:146130716-146130738 ACAGAACTGTGCACACCAGCAGG + Intergenic
941730136 2:168908428-168908450 ACAGTCTTCAGCATCCCAGCAGG + Intronic
948527291 2:238579246-238579268 ACAGACATTAACATGCCAGTAGG + Intergenic
948823585 2:240563056-240563078 ACAGACATGACCAGAGCAGCAGG + Exonic
1169824571 20:9753089-9753111 ACACACATGAGCCAACCAGCTGG + Intronic
1170396309 20:15929572-15929594 AAAGACAGCAGTATACCAGCAGG + Intronic
1175767584 20:61601919-61601941 AGAGACAGGAGCATACCAGGAGG + Intronic
1179998209 21:44983752-44983774 ACAGACCTGAGCACAGCAGGAGG - Intergenic
1184483495 22:44762108-44762130 ACAGACAGGAGCTGACCTGCAGG + Intronic
950102513 3:10366660-10366682 ACAGACATGGGCAGAACAGGGGG + Intronic
950860605 3:16144696-16144718 GCAAACATGGGCATAACAGCTGG + Intergenic
953088374 3:39697385-39697407 ACAGACACGAGCATGCGGGCAGG + Intergenic
953257205 3:41303703-41303725 ACAGACTTGAGCATGTCAGAAGG - Intronic
957547853 3:81663385-81663407 ACAGACATCAGCATGCCCGCAGG + Intronic
957895973 3:86421535-86421557 ACAGGCACTAGCATAGCAGCAGG - Intergenic
959390787 3:105770637-105770659 GCAGACAGGAGCATAGGAGCTGG + Intronic
961169618 3:124787773-124787795 CCAGAGATGAGCAGCCCAGCTGG + Intronic
961182863 3:124889735-124889757 ACAGACATGAGCCAACGCGCTGG - Intronic
961556416 3:127699178-127699200 ACAGCCAGGAATATACCAGCTGG + Intronic
961625784 3:128262646-128262668 AAAGACATGAGCCCAACAGCAGG + Intronic
961684835 3:128622596-128622618 ATAAAGATGAGCAGACCAGCCGG + Intronic
968703599 4:2067818-2067840 ACAGACATAAGCAAGTCAGCAGG - Exonic
971820111 4:31541155-31541177 ACAGAAATGAACCTACAAGCAGG - Intergenic
975868193 4:78747811-78747833 ACATACATGAGAATACCAGATGG - Intergenic
976312481 4:83625932-83625954 TCAGACATGAGTGTAGCAGCAGG - Intergenic
982315086 4:154023877-154023899 ACAGGCACCAGCACACCAGCAGG + Intergenic
984329634 4:178298103-178298125 ACAGACATGAGCAGAGCAGGAGG - Intergenic
984819911 4:183873097-183873119 ACAGATCTGAACATACCAACAGG - Intronic
985515506 5:342871-342893 ACAGGCATGTGCCTCCCAGCGGG - Intronic
985920522 5:2968300-2968322 GCACACATGTACATACCAGCAGG - Intergenic
987319651 5:16756654-16756676 ACAGACAGTAGAACACCAGCCGG - Intronic
987438164 5:17923510-17923532 ACAGACTTGAGCATCCCACCTGG - Intergenic
987651644 5:20748951-20748973 ACAGTCATGTACATACCACCAGG + Intergenic
988743915 5:34112525-34112547 ACAGTCATGTACATACCACCAGG - Intronic
989818571 5:45765913-45765935 ACAGACAGGAGCATAGGAGGTGG - Intergenic
990302623 5:54463773-54463795 ACAGGCATGAGCCTAGCAACTGG - Intergenic
990406621 5:55497647-55497669 ACAGCCATCAGGATCCCAGCAGG + Intronic
992635241 5:78720221-78720243 ACAGACCTGAGCAGATCTGCTGG - Intronic
993336972 5:86671740-86671762 GCTGACAAGAGCATACCAGATGG - Intergenic
996235043 5:121117112-121117134 ACAGAAATGAGTATAGTAGCTGG - Intergenic
996482158 5:123988013-123988035 TCATACAAGAGCATTCCAGCTGG - Intergenic
997139289 5:131361839-131361861 ACAGACACCAGCATGCCAGCAGG - Intronic
999255083 5:150205573-150205595 ACAGCCACCAGCATGCCAGCTGG - Exonic
999803613 5:155061081-155061103 ACAGACATGAGCCTAACAGAGGG - Intergenic
1000541861 5:162550439-162550461 ACAGGCACGGGCACACCAGCAGG + Intergenic
1002060344 5:176621879-176621901 CCAGACAGGCGCAGACCAGCGGG + Intronic
1003912028 6:10751795-10751817 TAAGACATGAGCATAGAAGCAGG + Intronic
1004953637 6:20702595-20702617 ACAGACACCAGCAGGCCAGCAGG - Intronic
1005794782 6:29348061-29348083 ACAGGCACCAGCATACCAGCAGG - Intergenic
1008661378 6:53671524-53671546 ACAGACATGAGCCTACGACCTGG + Intergenic
1011326336 6:86152650-86152672 ACAGAGATGGGCATGCCAGCAGG - Intergenic
1014531865 6:122568772-122568794 GCAGACATGAGCACAGGAGCTGG + Intronic
1018661649 6:166092848-166092870 ACAGACAAAAGCATTCCAACTGG - Intergenic
1019531393 7:1505224-1505246 ACAGGCATGAGCATCACACCTGG - Intergenic
1024422036 7:49179602-49179624 ACACACATGACCATACCAAGAGG + Intergenic
1026854914 7:73746857-73746879 ACAGACGTGACCATCACAGCCGG - Intergenic
1034110066 7:148528230-148528252 ACTGACATGAGCTGACCAACAGG + Intergenic
1035339776 7:158152786-158152808 ACAGACACCAGCATGCCAGCAGG + Intronic
1035339785 7:158152838-158152860 ACAGACACCAGCACGCCAGCAGG + Intronic
1035339794 7:158152890-158152912 ACAGACACCAGCACGCCAGCAGG + Intronic
1035339801 7:158152942-158152964 ACAGACACCAGCACGCCAGCAGG + Intronic
1035339810 7:158152994-158153016 ACAGACACCAGCATGCCAGCAGG + Intronic
1035339821 7:158153046-158153068 ACAGACACCAGCACGCCAGCAGG + Intronic
1036087132 8:5624520-5624542 ACAGACATGATCCTACCTTCAGG - Intergenic
1041740313 8:61150664-61150686 ACACACATGCACACACCAGCTGG - Intronic
1041954046 8:63537619-63537641 ACTGACATGAGCATCATAGCAGG + Intergenic
1041971607 8:63749455-63749477 ACAGCCATGCACATACCTGCTGG + Intergenic
1043719627 8:83531326-83531348 ACAAACTTCACCATACCAGCTGG + Intergenic
1045321472 8:101085064-101085086 ACAGACATGTGCATGCCAATAGG + Intergenic
1046557931 8:115799098-115799120 AAACACATGATCATATCAGCAGG + Intronic
1051102478 9:13536772-13536794 TTACACATGAGGATACCAGCTGG + Intergenic
1052816396 9:33105415-33105437 ACAGACATGAGCCACCAAGCCGG + Intronic
1055243916 9:74217902-74217924 ACAGGCACCAGCATGCCAGCAGG + Intergenic
1057381129 9:94568447-94568469 ACAGACATGAGCATTTAAGGTGG - Intronic
1060787556 9:126462654-126462676 GCAGAAATTAGAATACCAGCAGG + Intronic
1061623363 9:131825673-131825695 ACAGAAATGAACGTTCCAGCTGG - Intergenic
1062729213 9:138099697-138099719 ACAGACATGTGCACACCCACAGG - Intronic
1188684658 X:33054933-33054955 ACATACATGAGCATAACTGATGG + Intronic
1190915975 X:54811390-54811412 AGAGACATAAGCATAAGAGCAGG - Intronic
1192388270 X:70696489-70696511 ACAGACATGAGCCATCCACCTGG - Intronic
1193183644 X:78487005-78487027 ACAGGCACCAGCATGCCAGCAGG - Intergenic
1193358449 X:80551277-80551299 ACAGATATCGGCATACCAGCAGG - Intergenic
1194566930 X:95500619-95500641 ACATACATGGGCATGCCACCAGG - Intergenic
1194583712 X:95707484-95707506 AGAGACATCAGCAAACCAGAAGG - Intergenic
1197130648 X:123001963-123001985 ACAAAAATGTGAATACCAGCAGG - Intergenic
1200253391 X:154565815-154565837 AAAGATATGAGCAGCCCAGCGGG - Intergenic
1200264376 X:154638593-154638615 AAAGATATGAGCAGCCCAGCGGG + Intergenic
1200698042 Y:6378426-6378448 ATAGACATGAGGATACAATCTGG - Intergenic
1201036070 Y:9786273-9786295 ATAGACATGAGGATACAATCTGG + Intergenic