ID: 911184130

View in Genome Browser
Species Human (GRCh38)
Location 1:94886514-94886536
Sequence CCTCCTACCCTGCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911184124_911184130 27 Left 911184124 1:94886464-94886486 CCTGCTGGTATGCTCATGTCTGT 0: 1
1: 0
2: 0
3: 19
4: 139
Right 911184130 1:94886514-94886536 CCTCCTACCCTGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911184130 Original CRISPR CCTCCTACCCTGCTGGAGAC AGG Intronic
No off target data available for this crispr