ID: 911184448

View in Genome Browser
Species Human (GRCh38)
Location 1:94889064-94889086
Sequence GTTTGGTTCTTAAAGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 288}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911184448_911184453 12 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184453 1:94889099-94889121 CTGGCCTTGAAGAGGGAGTTTGG No data
911184448_911184449 -7 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184449 1:94889080-94889102 ACCAAACATTCTTCTCTTGCTGG No data
911184448_911184456 21 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184456 1:94889108-94889130 AAGAGGGAGTTTGGTAAATTGGG 0: 1
1: 0
2: 0
3: 19
4: 224
911184448_911184452 5 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184452 1:94889092-94889114 TCTCTTGCTGGCCTTGAAGAGGG No data
911184448_911184451 4 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184451 1:94889091-94889113 TTCTCTTGCTGGCCTTGAAGAGG 0: 1
1: 0
2: 6
3: 29
4: 255
911184448_911184455 20 Left 911184448 1:94889064-94889086 CCTTTTGTCTTTAAGAACCAAAC 0: 1
1: 0
2: 1
3: 22
4: 288
Right 911184455 1:94889107-94889129 GAAGAGGGAGTTTGGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911184448 Original CRISPR GTTTGGTTCTTAAAGACAAA AGG (reversed) Intronic
900520514 1:3103218-3103240 GTTTGTTTTTTCAAAACAAAGGG + Intronic
901028069 1:6289700-6289722 GTTTTGTTTTTAAAGAAACAGGG + Intronic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
902819408 1:18934727-18934749 GATTGGTTTTTAACGACAACGGG + Intronic
903138391 1:21324123-21324145 GTTTTGTTTTTAAAGAGACAAGG + Intronic
904489265 1:30848125-30848147 GTGTGCATGTTAAAGACAAAGGG - Intergenic
904861650 1:33542353-33542375 GTTTGATTCTAAGAGATAAAAGG + Intronic
906094347 1:43210704-43210726 TTTTGGTTTTACAAGACAAAAGG + Exonic
907092357 1:51738207-51738229 GTTTTGTTCTATAAGTCAAAGGG + Intronic
907375828 1:54038787-54038809 GTATTGTTCTAAAAGTCAAATGG + Intronic
907477737 1:54716938-54716960 TCTTGATTCTTTAAGACAAAAGG - Intronic
908207762 1:61869047-61869069 GTTTGTTTAGGAAAGACAAACGG + Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
911379803 1:97098970-97098992 GTTTGGTTTGTATAGACAGAAGG + Intronic
912725687 1:112057219-112057241 GCATGGATCTTAAAGTCAAAAGG - Intergenic
913291026 1:117271999-117272021 GTTTGGCCCTTTACGACAAAAGG + Intergenic
913692409 1:121291603-121291625 GTTTTGTTTTTTAAGGCAAAGGG + Intronic
914817332 1:151072540-151072562 GTTTGTTTTTTAAAGAGACAGGG - Intronic
914953523 1:152140923-152140945 GCTTGGTTCTCAAAGAAAACAGG + Intergenic
915834673 1:159166745-159166767 GTTTGGTTCTGAAGGAAAGATGG - Intergenic
918822728 1:189277158-189277180 TTTTGTTTTTTAAACACAAAAGG - Intergenic
919777496 1:201203753-201203775 GTTTGGTTGTTGAAGCCATAGGG - Exonic
920233625 1:204487110-204487132 GTTTGTTTTTTAAAGAGACAGGG + Intronic
920479729 1:206309960-206309982 GTTTTGTTTTTTAAGGCAAAGGG + Intronic
920807621 1:209250046-209250068 GTTTGGTTTATAAAAAGAAAGGG + Intergenic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921619339 1:217308925-217308947 GTGTGCTTCTAAAAGACAACAGG - Intergenic
921745310 1:218733649-218733671 GTTTGCTTCTTTAAGACCAGGGG - Intergenic
923361377 1:233214773-233214795 GTTTGATTCTAAAAGAAAATAGG - Intronic
924071237 1:240281941-240281963 GTTTGGACCTTAAAAATAAAAGG - Intronic
924389699 1:243540085-243540107 GTTTGCTTTTTAAAAACAAAAGG - Intronic
924761314 1:246989709-246989731 GTGTGTTTCTTAAAGGCAACAGG - Intronic
1063489239 10:6447937-6447959 GTTTGGTTTTTGAGGGCAAAAGG + Intronic
1065362998 10:24906831-24906853 CTTTGGTTCTAAAAGGCACAGGG + Intronic
1067328578 10:45293091-45293113 GTTTGGAACTGAAAGACAATAGG + Intergenic
1068537736 10:58258722-58258744 GTTTAGTACTTAAAGGGAAATGG + Intronic
1068625179 10:59237404-59237426 GTTTCTTTCTAAAAGACAAAAGG - Intronic
1070189090 10:74094925-74094947 GTTTTGTTTTTAAAGAGACATGG - Intronic
1071976150 10:90957314-90957336 GTTTGATTTTTAAAGCCAATGGG - Intergenic
1073315005 10:102573778-102573800 GTTAGGTTCATAGAGACAGAAGG + Intronic
1073315518 10:102578009-102578031 TCTTTGTTCTTAAAGCCAAAGGG - Intronic
1074007292 10:109440090-109440112 AATAGGTTTTTAAAGACAAAAGG + Intergenic
1075495248 10:122914266-122914288 AGTAGGTTCTTAAAGGCAAAGGG - Intergenic
1075708451 10:124517334-124517356 GTTTTGTTCTTCAAAATAAAGGG + Intronic
1076133026 10:128026749-128026771 CTTTGCTTGTTAAAGAGAAAAGG - Intronic
1076750520 10:132539856-132539878 GTTTGGTTTTTATTAACAAAAGG + Intronic
1078489835 11:11758533-11758555 GTTCAGTTCTAAAAGGCAAAGGG + Intergenic
1080138554 11:28887872-28887894 GTTTGGTTGTTAAAGTGAAGAGG - Intergenic
1080389227 11:31828444-31828466 GTTTGTTTCTTTAAAAAAAACGG - Intronic
1081843184 11:46218496-46218518 CATCGGTTCTTAAAGACATATGG - Intergenic
1082090904 11:48089063-48089085 AAGTGGTTCTTAAAGACAACAGG - Intronic
1085112370 11:73899264-73899286 TTTTAGGTCTTAAACACAAAGGG + Intronic
1087049871 11:93875388-93875410 GACTGGTTGTTTAAGACAAAGGG - Intergenic
1087287730 11:96283522-96283544 TTTTAGTTCTTCAAGGCAAAAGG - Intronic
1087604825 11:100364916-100364938 GTTTGCATCTTAAAGACAGCTGG - Intergenic
1088440132 11:109861193-109861215 GTTTGTGTCTTAGAGACTAATGG - Intergenic
1090119672 11:124012950-124012972 GTTTGGTCCTTAAATAGAAATGG + Intergenic
1090120355 11:124020518-124020540 GTTTGGTCCTTGAATAGAAAGGG + Intergenic
1090120923 11:124027117-124027139 GTTTGGTCCTTAAGTAGAAAAGG + Intergenic
1090774119 11:129947949-129947971 GTTTAGTTTTAAAAGACAAGTGG - Intronic
1091137892 11:133208892-133208914 GTTTGGTTCTTAGACACCAGAGG - Intronic
1091484617 12:872768-872790 TTTCGGTTCTTAATTACAAATGG + Intronic
1092038049 12:5358077-5358099 GTTTTGTTTTTAAAGAAACAGGG + Intergenic
1092218634 12:6698831-6698853 GGTTGGTTTTGAAAGAGAAAGGG + Intronic
1092404202 12:8206136-8206158 GTTTTATTCTAAGAGACAAACGG - Intergenic
1096282901 12:50272043-50272065 GATTAGTTATTAAGGACAAAGGG - Intronic
1097713753 12:62943117-62943139 GTTTGTTTAGGAAAGACAAATGG + Intergenic
1098702569 12:73647010-73647032 CTTTGGTTCTTAGCAACAAAGGG - Intergenic
1099307528 12:80976548-80976570 GTTTCGTTCTTGAAGAAAATTGG - Intronic
1100178347 12:92056625-92056647 GTTTATTTCTTAAAAAAAAAAGG + Intronic
1100395889 12:94186069-94186091 ATTTTTTTCTTAAAGACACAGGG - Intronic
1100493306 12:95101605-95101627 GCTTGGTTCTTAAAATCAAGAGG - Intronic
1103223983 12:119270776-119270798 GTATGGATATTAAGGACAAAGGG + Intergenic
1104218699 12:126760844-126760866 GTTTGATTCTTAAATGCAAGAGG + Intergenic
1105688953 13:22816327-22816349 ATTTAATTCTTAAAGAAAAAGGG + Intergenic
1106981457 13:35287424-35287446 ATATGGTTTTGAAAGACAAAAGG - Intronic
1107096679 13:36545118-36545140 GTTTTGGTATCAAAGACAAAGGG - Intergenic
1107324014 13:39220827-39220849 GTTTATCTCTTAAAGACAGAAGG - Intergenic
1107940047 13:45375371-45375393 ATTTGGTTCATGAAGACATATGG + Intergenic
1108706528 13:52993526-52993548 TCCTGGTTCATAAAGACAAAGGG + Intergenic
1113048597 13:106183760-106183782 GTTCGGTTCTTAGAGCAAAATGG - Intergenic
1115945739 14:38658105-38658127 GTTTGGTCCTGAAAGAGAAAAGG - Intergenic
1116160296 14:41259142-41259164 ATTTTGTTTCTAAAGACAAATGG - Intergenic
1116163276 14:41298319-41298341 ATTTAGTTCATAAAAACAAATGG + Intergenic
1116575570 14:46570185-46570207 GTTTGTTTCATAATGATAAAGGG + Intergenic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1117474912 14:56084282-56084304 GTTTTCTTCTTAAAGACAGGAGG - Intergenic
1117666014 14:58056783-58056805 GTTTTGTTGTTACAGAAAAAGGG - Intronic
1119445554 14:74660540-74660562 GTTTTGTTTTTAAATTCAAAAGG + Intronic
1120121359 14:80683373-80683395 GGATGGTACATAAAGACAAAGGG + Intronic
1120466380 14:84863185-84863207 TATTGATTCTTATAGACAAAGGG - Intergenic
1121402565 14:93693061-93693083 TTTTGGTTCTTAATTAGAAAGGG + Intronic
1122750723 14:103930617-103930639 ATTTGGTTCTTAGAGGCATAGGG + Intronic
1125103706 15:35946176-35946198 GTTTTGTTTTGAAAAACAAATGG + Intergenic
1125786916 15:42327034-42327056 TCTTGGTTCTTAAAGAGAACAGG - Intronic
1126893349 15:53230822-53230844 TTTTGGAGCTTAAAGAAAAAAGG + Intergenic
1127374408 15:58369837-58369859 GTTTGGTTGATAGAGACACAGGG + Intronic
1127451713 15:59122961-59122983 GTTTGGTGCTTAACTACACAGGG + Intronic
1128117074 15:65115348-65115370 GATTAGTTCTTAAATACTAAGGG - Intergenic
1134538869 16:15048390-15048412 GTTTGTTTTTTAAAGACACAGGG + Intronic
1134758814 16:16694993-16695015 TTTTGTTTCTCAAAGACAACAGG - Intergenic
1134987261 16:18664178-18664200 TTTTGTTTCTCAAAGACAACAGG + Intergenic
1136009203 16:27351815-27351837 GTTTGTTTTTTAAAGAGAGATGG - Intronic
1138467889 16:57206567-57206589 GTTTTGTTTTTAAAGAGACAGGG + Intronic
1138481791 16:57308025-57308047 GTTTGGTACCCAAAGACTAAGGG - Intergenic
1138920215 16:61518482-61518504 CTTTGGCTCTTAAAGAGAAGAGG + Intergenic
1140384702 16:74525381-74525403 GTTTGCTTTTTAAAGAGACAGGG + Intronic
1143555526 17:7657369-7657391 GTTTTTTTTTTAAAGGCAAAGGG - Exonic
1145123053 17:20277984-20278006 CTTTGGTTCTGGAAGACACAAGG - Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1149442960 17:56690624-56690646 GTGGGATTCTTGAAGACAAAGGG + Intergenic
1150360371 17:64527455-64527477 TTTTATTTCTTAAACACAAAGGG - Intronic
1151012886 17:70521481-70521503 GCTTGGTTTTTTAAGATAAAGGG + Intergenic
1153083012 18:1250155-1250177 TTTTGGTTCTTCAAGAAGAAAGG - Intergenic
1153283741 18:3438247-3438269 GTTTAGTTTTTAAAACCAAATGG + Intronic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1154032943 18:10769091-10769113 GTTAGGGTATTAAAGAGAAATGG - Intronic
1155134519 18:22975635-22975657 GTTTTATTCTTTAAGAGAAATGG - Intronic
1155991241 18:32281669-32281691 TTTCTGTTCTTAAAGACAGATGG + Intronic
1156551219 18:38019428-38019450 TTCTGTTTCTTACAGACAAATGG + Intergenic
1156919700 18:42506073-42506095 GTTTGGTATTAAAAGATAAAAGG + Intergenic
1157243922 18:46037093-46037115 TTGTGGTTCTTAGAGACAAGAGG - Intronic
1158277481 18:55783727-55783749 GGTTATTTTTTAAAGACAAAAGG + Intergenic
1159978598 18:74748571-74748593 CTTTGGCTTTTAAAGTCAAAAGG - Intronic
1160382433 18:78470881-78470903 GTCTGGTTCTCAGAGACAAGAGG + Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1168034360 19:53707227-53707249 GTTTTGTTCCCAAAGAGAAAAGG - Intergenic
925757031 2:7143150-7143172 GTTTGCTTCTTTAAGACTATAGG + Intergenic
926093942 2:10068706-10068728 TTTTGGTTCATAAATATAAATGG + Intronic
927111127 2:19864401-19864423 CTTGGGGTCTTGAAGACAAATGG - Intergenic
927263229 2:21115719-21115741 GTTTGGTTTTTAAAGAAGTAAGG + Intergenic
928865796 2:35916319-35916341 TTTTGTTTTTTAATGACAAAAGG + Intergenic
933010723 2:77059281-77059303 GTTTATTACTGAAAGACAAATGG - Intronic
933553061 2:83799040-83799062 GTGTGATTCTTAAATACCAATGG + Intergenic
935333578 2:101995307-101995329 GTTTGTTTCTTCAAGGCCAATGG - Intronic
935603296 2:104944610-104944632 ACTTGGTTCTTAAAGAAGAAAGG - Intergenic
937880435 2:126860320-126860342 GTTCTGTTGTTAAAGAAAAAGGG - Intergenic
938756488 2:134384451-134384473 GTTTGGTTCTTATGTACAAAGGG - Intronic
938968336 2:136407998-136408020 ATCTGGTTTTAAAAGACAAAAGG + Intergenic
939428313 2:142070152-142070174 GGTTTGTTCTTTAAGGCAAACGG + Intronic
939992952 2:148893134-148893156 GTTTTGTTTTTAATCACAAATGG + Intronic
940076515 2:149748287-149748309 GTTTGGCTCTGGAAAACAAAGGG + Intergenic
940554181 2:155202055-155202077 GTTTGATACTTACAGCCAAAGGG + Intergenic
941493967 2:166178031-166178053 GTATGATTCTTATACACAAAGGG - Intergenic
942074382 2:172343244-172343266 GTTTGCTTCCTTAAGAAAAAAGG + Intergenic
942709507 2:178817277-178817299 GTTTATTTCTTTAAGAGAAAAGG + Intronic
943712162 2:191109308-191109330 GTTTTTTTTTTAAAGACAAGTGG + Intronic
943754388 2:191542616-191542638 ATATGGTTCTTAAAGACATTAGG - Intergenic
943919527 2:193686032-193686054 GTTTTATTTTTAAGGACAAATGG + Intergenic
944490310 2:200251908-200251930 ATTTTGTTCTTAAAGTCAGAAGG - Intergenic
947522062 2:230854291-230854313 GGATGGTTCTTTCAGACAAAAGG - Intergenic
947556996 2:231101825-231101847 GTTTGTTTTTTAAATACAGAGGG + Intronic
947562044 2:231163385-231163407 GGTTTGTTCATAAAGATAAAGGG + Intronic
1169025426 20:2366778-2366800 GTTTTGTTTTTAAAGAAGAACGG + Intergenic
1169186141 20:3618848-3618870 GTTTCGTTTTTTAAGAAAAAAGG + Intronic
1169368656 20:5011522-5011544 GTTTTGTTTTTAAAGAAAAGAGG + Intergenic
1169637666 20:7710735-7710757 GTACTGTTCTTAGAGACAAAAGG + Intergenic
1172919659 20:38470818-38470840 GTTTGTTTTTTTAAGACACAGGG - Intergenic
1174334379 20:49848287-49848309 ATTTGGTTTTTCAAAACAAAGGG - Intronic
1177879810 21:26678851-26678873 CTTGAGTTCTTAAAGAAAAAAGG - Intergenic
1178298871 21:31434478-31434500 GTTTGCTTCTTGATGGCAAATGG + Intronic
1178619287 21:34159707-34159729 GTTTGGTTTTGAAAGAGAAGAGG + Intergenic
1178688165 21:34728015-34728037 GTTTGCTTCTTCAAGGCCAATGG + Intergenic
1178896788 21:36565355-36565377 GGTTGGTTCTGAAGGACCAATGG - Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1183134896 22:35878087-35878109 GTTTTGTTTTTAAAGATACAGGG + Intronic
1184674259 22:46031981-46032003 CTTTGGTTCTTAAAACAAAACGG + Intergenic
951575243 3:24106844-24106866 GTTTGGTGGTGAAAGAGAAAGGG + Intergenic
952058759 3:29481353-29481375 GTTAGGTTCTAGAAGGCAAATGG + Intronic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
955705005 3:61718900-61718922 GTTTGGTTCTTAAGTTGAAAGGG + Intronic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
956817980 3:72925815-72925837 GCTTGGTTTTGAATGACAAATGG + Intronic
957184699 3:76926666-76926688 GGTAGGTTCTTAAAGAGAAGGGG + Intronic
957436617 3:80185545-80185567 GTTTACATCTTAAAGTCAAAGGG - Intergenic
957762744 3:84580006-84580028 GTTTGTTTTTTAAAGATAAAGGG + Intergenic
958521186 3:95188493-95188515 ATTTGGTTCTTAAAGTCCTAGGG + Intergenic
961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG + Intergenic
963187416 3:142434748-142434770 GTTTGTTTTATAGAGACAAAGGG - Intronic
963377183 3:144483179-144483201 CTTTGGTTCTTATAGGCAACAGG + Intergenic
963486224 3:145937205-145937227 GTATGGTACTGAAAGACAGAGGG - Intergenic
963910156 3:150810001-150810023 GCTGGGTTCTTAAAGGGAAAGGG - Intergenic
963945983 3:151146037-151146059 GTTTGGTTTTTTATCACAAATGG - Intronic
963950017 3:151189260-151189282 GTGAGGTTCTTTGAGACAAAGGG + Intronic
965435319 3:168643546-168643568 GTTTAGTATTTATAGACAAATGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
965715415 3:171597361-171597383 TTTTGGTTCTGAAAGAGAAGTGG - Intergenic
966197609 3:177328882-177328904 GCTTGGATCTTAGAGACAATGGG + Intergenic
966948035 3:184791212-184791234 GATTGGTTCTGAGAGAGAAAGGG + Intergenic
968197189 3:196716843-196716865 GTTTGGTTCTTATAGGCATAAGG + Exonic
969077560 4:4592348-4592370 GTTTGTTGCTTATAGCCAAAGGG - Intergenic
969259841 4:6026397-6026419 GTTGGGTTCGGAAAGAGAAATGG + Intronic
969435624 4:7187663-7187685 GTGTGGTTCTTGAAGCCAAGAGG + Intergenic
971707121 4:30059102-30059124 GGTAGGTTCTTAAACACAAATGG - Intergenic
972717976 4:41667649-41667671 ATTGGGTTCTTAAAGAGTAAAGG - Intronic
972735333 4:41835155-41835177 GCTTTGTTCTTGAAGTCAAATGG - Intergenic
973147118 4:46840961-46840983 AGTTGGTGCATAAAGACAAAGGG + Intronic
973219487 4:47709083-47709105 TTTGGGTTGTTAACGACAAATGG - Intronic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976658196 4:87511371-87511393 GTTTGGTTTTAGAAGACAGACGG + Intronic
977364839 4:96054856-96054878 TCTTGGTTCTCAAAGAGAAAAGG - Intergenic
978928702 4:114284227-114284249 GTTGGATTCTTAAATTCAAAGGG - Intergenic
980215205 4:129843825-129843847 GTTTGAATCTTAAAGAGGAATGG + Intergenic
980490127 4:133513957-133513979 GTTAAATTCTTACAGACAAAAGG + Intergenic
980881225 4:138711866-138711888 GTCAGGGCCTTAAAGACAAAGGG - Intergenic
981282988 4:142982301-142982323 GTCTGGTTATTAAATAAAAATGG + Intergenic
982333339 4:154206845-154206867 GTTTGGTTCTTATTTCCAAAAGG - Intergenic
982755598 4:159215177-159215199 GTTTGGTTTTTAAAGAGACAGGG + Intronic
983589744 4:169395480-169395502 GTTGGATTCTGAAAGACAAATGG - Intronic
984182609 4:176503230-176503252 CTTTGTTTCTTCAAGAAAAATGG - Intergenic
985844688 5:2335440-2335462 GTTTGCCTATTAAAAACAAAGGG - Intergenic
986254338 5:6089277-6089299 GTGTGGTTCTAAAAGACATCAGG - Intergenic
986850917 5:11812668-11812690 GTTTGATGATTAAAGAAAAAAGG + Intronic
987010165 5:13754841-13754863 GCTTAGTTCTTAAAAACAAATGG + Intronic
987861260 5:23491241-23491263 GTTTGGTTCTTTCTGAAAAATGG + Intergenic
987874655 5:23665618-23665640 GTTTCGTTATTAAAAACAAGAGG + Intergenic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
989297850 5:39850764-39850786 TTTTGGTACATAAAGACAAAAGG - Intergenic
991058755 5:62348556-62348578 ATTTGTTTCTTAAAGAAAGATGG + Intronic
993922298 5:93820766-93820788 ATTTAGTCATTAAAGACAAAAGG - Intronic
995929886 5:117427761-117427783 GTTTTTTTCTTAAAGAAAAGAGG - Intergenic
995934354 5:117490270-117490292 ATTTTGTTTTTAAAGACAGATGG + Intergenic
996038450 5:118784266-118784288 ATGTGATTCTTAGAGACAAATGG + Intergenic
997483097 5:134204466-134204488 TTTTGTTTTTTAAAGACACAGGG + Intronic
997559999 5:134838074-134838096 GTTTTGTTTTTAAATACAGACGG - Intronic
998649503 5:144102253-144102275 CTTTGGCCCTTAGAGACAAATGG - Intergenic
999388809 5:151174936-151174958 GCTTGATTCTGAAAGACAGATGG - Intergenic
1000139316 5:158386269-158386291 GTTTTTTTCTTAAAGAGAGAAGG + Intergenic
1001000913 5:168006197-168006219 CTTTGGCTTTTAAAGATAAATGG - Intronic
1001320614 5:170677796-170677818 CTTTGTTTCTTTAAGGCAAATGG + Intronic
1001763411 5:174225680-174225702 GTCTGGTTCTTAAACACAGAAGG + Intronic
1003380657 6:5621759-5621781 GGTGGGTACTTTAAGACAAAGGG + Intronic
1004127318 6:12886249-12886271 GTTTGATTGTTAAAAAAAAAAGG + Intronic
1005302809 6:24487455-24487477 GTTTGGTACTTAATGAAGAAGGG + Intronic
1005820462 6:29594232-29594254 GTTTGGTTCTATAACAGAAAAGG + Intronic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1009782715 6:68291612-68291634 ATCTGGTTCTTCAAGTCAAAGGG - Intergenic
1010114086 6:72280794-72280816 ATTTGTTTCTTGAAGGCAAAGGG - Intronic
1010337465 6:74703719-74703741 AGTTGGTTCATAAAGAGAAAGGG - Intergenic
1012657469 6:101842887-101842909 GTTTGTTTCTCCAAAACAAATGG - Intronic
1013090368 6:106895002-106895024 GTTTGGGTATTAAAAGCAAAAGG - Intergenic
1014906161 6:127030925-127030947 GTTAGGTTCTTCAAGATAAAAGG + Intergenic
1015419804 6:132994056-132994078 GTTTGTTTTTTAAGGAAAAAAGG + Intergenic
1016081645 6:139864480-139864502 GTTTGGTTCATAAAGTTTAATGG + Intergenic
1016307771 6:142701318-142701340 GTTTGTTTCTAAAATAAAAATGG - Intergenic
1016774110 6:147885415-147885437 ATTTTGTTTTTAAAGAAAAAAGG - Intergenic
1016859282 6:148700608-148700630 GTTTGGCTCTAAAACAGAAAGGG - Intergenic
1017106164 6:150890291-150890313 GTTTGTTTGTTTAAGACAGAGGG + Intronic
1018217703 6:161546422-161546444 GTTTGGGATTTGAAGACAAAGGG + Intronic
1019232025 6:170574905-170574927 TTTTAATTCTTAAAGACATAGGG + Intergenic
1020404787 7:7819649-7819671 GTTTTGCTCTGAAAGAAAAATGG + Intronic
1021415143 7:20375633-20375655 GTTTGGGTGTTGAAGATAAAGGG - Intronic
1022380807 7:29858128-29858150 TTTTGGTTCTTAAAGTGAAATGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024478081 7:49835047-49835069 GACAGGTTCTTAAAGGCAAATGG + Intronic
1025553954 7:62279766-62279788 GTTTGCTTTTTAAAGAGAAAAGG - Intergenic
1025560826 7:62373508-62373530 GTTTGCTTTTTAAAGAGAAAAGG + Intergenic
1028363619 7:89999383-89999405 GGTAGGTTCTTAAAGCCACAGGG + Intergenic
1030668128 7:112304544-112304566 GTTTGGTTAATAAAGTAAAATGG - Intronic
1031897556 7:127368988-127369010 GTTTTCTTCTTAAAGAGTAAAGG + Intronic
1032616093 7:133472675-133472697 GTTTGGGACTCAAAGACAGAAGG + Intronic
1032639703 7:133752152-133752174 GTTTGTTTGTTTAAGAGAAAGGG - Intronic
1032906379 7:136372204-136372226 GTTTGTTTGTTAACAACAAATGG - Intergenic
1033057559 7:138073142-138073164 TTTTGGTTTTTAGAGAGAAAGGG - Intronic
1034717568 7:153257380-153257402 GTTTGGATGTTGAAGACCAAGGG + Intergenic
1037081473 8:14792727-14792749 TTTAGGTGCTTAAAGAGAAAGGG - Intronic
1037427591 8:18772995-18773017 GTTTGTGCCTTAAAAACAAAGGG - Intronic
1037857082 8:22379539-22379561 GTCTGGATCTTAAGGACACAGGG - Intronic
1039089316 8:33811677-33811699 ACTTGATTCTTAGAGACAAATGG + Intergenic
1040960539 8:53027409-53027431 GATTGGGTCTCCAAGACAAAGGG + Intergenic
1041183111 8:55269700-55269722 AATTGATTCTTAAAGACTAATGG - Intronic
1042400916 8:68345953-68345975 CTTTGGTTGTTAAATACAACTGG - Intronic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1044875544 8:96662439-96662461 GTCCAGTTCTTAAAGATAAATGG + Intronic
1046545816 8:115648635-115648657 TTTTTCTTCTTAAAAACAAAAGG + Intronic
1047103809 8:121710954-121710976 CTTTGGTTCTTCAAGAAATAGGG - Intergenic
1047335457 8:123931471-123931493 TTTTGGTTTACAAAGACAAAGGG + Intronic
1048319222 8:133385499-133385521 GTTTGTTACTGAAAGAGAAAGGG - Intergenic
1048600930 8:135917939-135917961 GTTTTTTTCCTGAAGACAAAAGG + Intergenic
1050254252 9:3777578-3777600 CTTGGGTACATAAAGACAAATGG + Intergenic
1050444090 9:5699923-5699945 TTGTGGTTCTTAAAGCCAAGAGG - Intronic
1050897694 9:10904088-10904110 GTCTGGTTCTTTAAAATAAATGG - Intergenic
1051883660 9:21866745-21866767 GATTTTTTCTTAAAGAAAAATGG - Exonic
1052308545 9:27038896-27038918 GTTTGATGCTTCAAGAAAAAAGG + Intronic
1052521612 9:29555106-29555128 ATATGGTTATTAAAGAAAAAAGG + Intergenic
1056150695 9:83784920-83784942 GTTTATTTTTTAAAGATAAAAGG + Intronic
1056319260 9:85421136-85421158 GTTCTGTTCTTAAAGAAGAAGGG + Intergenic
1057715548 9:97492455-97492477 GTGTGGTTTTTGAAGTCAAAAGG + Intronic
1058978656 9:110148726-110148748 GTTTGGTTTTTAAATACGAGTGG + Intronic
1059229290 9:112703544-112703566 GTTTTGTTTTTAAAGAGACAGGG - Intronic
1059620249 9:115996930-115996952 GTGTCTTTCTTAAAGACACATGG + Intergenic
1060800287 9:126540206-126540228 GTTTGTGTCATGAAGACAAAAGG - Intergenic
1186406143 X:9305061-9305083 AATTGTTTCTTAAAAACAAAGGG - Intergenic
1187001701 X:15187274-15187296 GTTTCCTTCTTACAGACACATGG - Intergenic
1187112468 X:16315634-16315656 GTTTGGTTCCGTAACACAAATGG + Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1187267747 X:17751278-17751300 ATTTGGTTCTTAAAGATAATGGG + Intronic
1187640106 X:21277996-21278018 GTTTGGTTCTTTCTGAAAAATGG - Intergenic
1188733064 X:33675979-33676001 GTATGGTTCTTAATAAGAAAAGG - Intergenic
1190318469 X:49165738-49165760 GTCTAGTTCTGAAAAACAAAGGG + Intronic
1193219079 X:78900787-78900809 ATTTGTTTGTTATAGACAAAGGG + Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1194840206 X:98731042-98731064 GATTAGTTCTTACAGACAAGAGG - Intergenic
1195380442 X:104265800-104265822 TTTTTGTTTTTAAAGCCAAAGGG - Intergenic
1197427407 X:126314287-126314309 ATTTGTTTCTGAAAGACAAATGG - Intergenic
1198039935 X:132840475-132840497 GTTAGGTACTTAGAGAGAAAGGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1198755377 X:139976852-139976874 GTTGGTTTCTTATAGACAGAAGG - Intergenic
1198938807 X:141930764-141930786 CTTAGTTTCTTCAAGACAAATGG + Intergenic
1199251889 X:145673103-145673125 GTTTGGTTCATAAGGAAATAAGG + Intergenic
1202046411 Y:20740650-20740672 GTTTTCTTCTTAAAGAAATATGG + Intergenic