ID: 911189423

View in Genome Browser
Species Human (GRCh38)
Location 1:94933002-94933024
Sequence CCCACTTCAGGAACCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911189417_911189423 -3 Left 911189417 1:94932982-94933004 CCACGGCCTCTCTGTCACGCCCC No data
Right 911189423 1:94933002-94933024 CCCACTTCAGGAACCTTCATGGG No data
911189418_911189423 -9 Left 911189418 1:94932988-94933010 CCTCTCTGTCACGCCCCACTTCA No data
Right 911189423 1:94933002-94933024 CCCACTTCAGGAACCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911189423 Original CRISPR CCCACTTCAGGAACCTTCAT GGG Intergenic