ID: 911189519

View in Genome Browser
Species Human (GRCh38)
Location 1:94933648-94933670
Sequence AAGTAGGTGTGGAGGTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911189510_911189519 18 Left 911189510 1:94933607-94933629 CCAGGAGGAAGGCACTGCTGGCA No data
Right 911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG No data
911189514_911189519 -7 Left 911189514 1:94933632-94933654 CCTGGGTATGTGCCTAAAGTAGG No data
Right 911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911189519 Original CRISPR AAGTAGGTGTGGAGGTAAGT TGG Intergenic
No off target data available for this crispr