ID: 911191622

View in Genome Browser
Species Human (GRCh38)
Location 1:94954469-94954491
Sequence AGAAATAAAGATACACGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911191622_911191625 4 Left 911191622 1:94954469-94954491 CCTCGCCGTGTATCTTTATTTCT No data
Right 911191625 1:94954496-94954518 TCACTGTGTTGTCTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911191622 Original CRISPR AGAAATAAAGATACACGGCG AGG (reversed) Intergenic
No off target data available for this crispr