ID: 911191623

View in Genome Browser
Species Human (GRCh38)
Location 1:94954474-94954496
Sequence AGGACAGAAATAAAGATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911191623_911191626 26 Left 911191623 1:94954474-94954496 CCGTGTATCTTTATTTCTGTCCT No data
Right 911191626 1:94954523-94954545 TTTTGACTTGCGCCTTTCTATGG No data
911191623_911191625 -1 Left 911191623 1:94954474-94954496 CCGTGTATCTTTATTTCTGTCCT No data
Right 911191625 1:94954496-94954518 TCACTGTGTTGTCTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911191623 Original CRISPR AGGACAGAAATAAAGATACA CGG (reversed) Intergenic
No off target data available for this crispr