ID: 911196447

View in Genome Browser
Species Human (GRCh38)
Location 1:94999896-94999918
Sequence GAGGAGAGATGGCCTGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911196447 Original CRISPR GAGGAGAGATGGCCTGCGCC AGG (reversed) Intronic
900613063 1:3552602-3552624 GAGGATCGACGGCCTGAGCCCGG + Intronic
901202210 1:7473231-7473253 GAGGGCAGATGGCCTGGGGCAGG - Intronic
901778238 1:11575383-11575405 GAGAAGAAGTGGCCTGTGCCCGG - Intergenic
901835886 1:11923811-11923833 GAGGAGAAGTGGCCTGAGACTGG - Intronic
903282606 1:22258456-22258478 GTGGAGGGATGGCTTGAGCCTGG + Intergenic
903298650 1:22362430-22362452 GAGGAAACATGGCCTGCTTCTGG + Intergenic
903593671 1:24477824-24477846 AAGGACAGATGGCCTGGCCCAGG - Intergenic
904329651 1:29749947-29749969 GAAGAGTGATGGCCTGGGCTGGG + Intergenic
904833653 1:33321150-33321172 GGGAAGAAATGGCCTGCTCCTGG + Intergenic
905471217 1:38193488-38193510 GAGGCGAGTGGGCCTGGGCCTGG - Intergenic
907384317 1:54116111-54116133 GAGGAGAGGTGGCCTGACCAAGG - Intergenic
907915993 1:58870571-58870593 GAGCAGACAGGGCCTGGGCCAGG - Intergenic
907931664 1:59006643-59006665 TGGGAGAGAGGGCCTGGGCCGGG + Intergenic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
910005622 1:82393146-82393168 GAGGAGAGATGACTTGCCCTGGG + Intergenic
910992820 1:93073516-93073538 GAGGGAAGATGGCTTGAGCCTGG - Intergenic
911196447 1:94999896-94999918 GAGGAGAGATGGCCTGCGCCAGG - Intronic
911615301 1:100004396-100004418 GAGGGAAGATGGCTTGAGCCTGG - Intronic
913226696 1:116706961-116706983 GATGAGAGATGGTCAGAGCCAGG + Intergenic
913289486 1:117258978-117259000 GAGCAGAGAGGCCCTGGGCCTGG + Intergenic
914837235 1:151217673-151217695 GTGGGAAGATGGCCTGGGCCTGG - Intronic
915161662 1:153924673-153924695 GTGGAAAGATGGCTTGAGCCTGG - Intergenic
915740337 1:158114062-158114084 AAGGAGAGATGGCCTAGGACAGG - Intergenic
916506077 1:165429153-165429175 GAGGGGAGAGGGCCTGCTCTAGG + Intronic
916673972 1:167050688-167050710 GGGGTGAGATGGCCTGGGTCAGG + Intergenic
917861277 1:179146966-179146988 GCCCAGAGATGGCCTGAGCCTGG + Intronic
921819479 1:219600884-219600906 GAGATGAGGTGGCCTGGGCCAGG + Intergenic
921936231 1:220799645-220799667 GAGGTGAGGTGGCCTGCCCTAGG + Intronic
921996715 1:221427011-221427033 GAGAAGAGATGGCTTGTGCAGGG + Intergenic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
1062953715 10:1526195-1526217 TTGGAGAGATGGCCTGGGGCAGG + Intronic
1063338750 10:5243295-5243317 GAGGAGAGATTGCCTGCAGATGG + Intergenic
1064736618 10:18388050-18388072 GATGAGAAATGGCTTGGGCCAGG - Intronic
1065396583 10:25245300-25245322 CAGAAGACATGGCCTGGGCCAGG - Intronic
1069965319 10:72110436-72110458 GAGTGGAGATGGCCTGAGGCTGG - Intronic
1072749919 10:97970545-97970567 GGGGAGAGCTGGCCTGAGGCAGG - Intronic
1073117884 10:101102377-101102399 CAGGAGAAATGGCCTGCGGGAGG - Intronic
1074771903 10:116740351-116740373 GAGCAGAGTTGGCTTGCCCCTGG - Intronic
1075498840 10:122953922-122953944 GAGGCGAGAGGGTCTGAGCCCGG - Intronic
1076273619 10:129177874-129177896 GAGGAGACCTGGCCTGAGCGTGG - Intergenic
1076710280 10:132329818-132329840 GAGAAGACACGGCCAGCGCCAGG + Intronic
1076827283 10:132975382-132975404 GAGGAGACACAGCCTGCGCCGGG - Intergenic
1077043093 11:533148-533170 GGGGAGAGCTGCCCTGAGCCAGG - Intronic
1077896399 11:6456723-6456745 CACGGGAGAGGGCCTGCGCCAGG - Exonic
1081080504 11:38733880-38733902 GGGAAGCGAGGGCCTGCGCCTGG + Intergenic
1083332817 11:61906877-61906899 GAGGCGACATGGCCTGCCCAAGG + Intronic
1083989994 11:66241012-66241034 CTGGAGAGAAGGCCTGAGCCCGG - Intronic
1084379373 11:68801332-68801354 GAGGAGAGATGGGGTGGGCCAGG + Intronic
1084594227 11:70107505-70107527 GCGGTCAGATGGCCTGGGCCAGG + Intronic
1084676294 11:70637449-70637471 GAGGAGAGCTGGCCGTGGCCCGG - Intronic
1085474301 11:76780218-76780240 GAGGAGTGATGGTTTGCACCTGG + Intergenic
1087666587 11:101056341-101056363 GTGAAGAGATGGCCTGGGGCTGG + Intronic
1089359576 11:117876832-117876854 GAGGAGAGGGGGTCTGCGCGCGG - Exonic
1089452956 11:118609937-118609959 GAGGAGAGATGGGCGGCCCGAGG - Intronic
1091723564 12:2830526-2830548 GAGGAGACATGGCTTGGGGCAGG + Intronic
1092450519 12:8597513-8597535 GAGCAGAAATGGCCTAGGCCAGG - Intergenic
1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG + Intergenic
1093047052 12:14458727-14458749 GTGGAAAGATGGCCTGAGCCCGG + Intronic
1093334186 12:17880513-17880535 AAGGAGAGATGGCATGCACAGGG + Intergenic
1096510965 12:52128073-52128095 GAGGAGATCTGGCCTTTGCCAGG - Intergenic
1096533656 12:52257396-52257418 GAGGCCAGGTGGCCTGCTCCTGG + Intronic
1097344707 12:58477951-58477973 GAGGAGTGATGGCCTAAGGCAGG - Intergenic
1098041570 12:66358538-66358560 CAGGAGAAATCGCCTGAGCCTGG - Intronic
1100186665 12:92146269-92146291 GAGTAGACACAGCCTGCGCCAGG - Intergenic
1101647099 12:106641490-106641512 GAGGAGACGGGGCCTGCTCCAGG - Intronic
1106231649 13:27825599-27825621 GAGGAGAGGTGGCCTGAGGCTGG - Intergenic
1109208179 13:59505058-59505080 GAGGAGAGATGGCCACCCCTAGG + Intergenic
1110826165 13:79974454-79974476 GAGAAGAGATTGCCTGGGCAGGG + Intergenic
1111239630 13:85457545-85457567 GAGGAGTGAGGCCCTGGGCCTGG - Intergenic
1112601519 13:100860109-100860131 GAGAAGACATGGCCTCCTCCTGG + Intergenic
1113760421 13:112842593-112842615 GGGAGGAGATGGCCTGTGCCTGG - Intronic
1113764012 13:112869619-112869641 GAGGAGAGCTGGGCAGCGTCAGG + Intronic
1113767544 13:112890515-112890537 GTGGGGTGGTGGCCTGCGCCGGG - Intergenic
1113808746 13:113124499-113124521 GGAGAGAGATGGCCTGGCCCTGG - Intronic
1117234299 14:53754903-53754925 GAGCAGAGATGCCCTGGGTCTGG - Intergenic
1117389114 14:55246531-55246553 GTGGAAAGATGGCTTGAGCCTGG - Intergenic
1122265356 14:100544250-100544272 GAGGACAGATGACTTGTGCCTGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123049368 14:105533269-105533291 GAAGAAAGATGGGCTGAGCCTGG - Intergenic
1123804232 15:23854725-23854747 GAGGAGGGAGGGCCTGTGCTGGG + Intergenic
1125277067 15:38004363-38004385 GAGGAGAGGTGACCTTCCCCTGG + Intergenic
1128126436 15:65196790-65196812 GAGCAGGGGTGGCCAGCGCCAGG - Exonic
1128342654 15:66833529-66833551 GAGGAGAGACGACTTGCACCAGG - Intergenic
1129986373 15:79923131-79923153 GAGGAGAGCTGGTGAGCGCCGGG - Intronic
1130352627 15:83105871-83105893 GAGGAGGTATGGCCTGCTCCAGG - Intergenic
1131472534 15:92709398-92709420 GAGGAGAGAGAGCCTGGGGCAGG - Intronic
1132046502 15:98567131-98567153 GGGGAGAGATGGCCTATGCATGG + Intergenic
1132583344 16:695115-695137 GACGAGGGATGGCCGGGGCCAGG - Intronic
1132676567 16:1123606-1123628 AGGGAGAGATGGCCTGACCCAGG + Intergenic
1132859466 16:2062882-2062904 GAGTCGGGCTGGCCTGCGCCAGG + Intronic
1133166342 16:3950222-3950244 GAGGGGAGATGGCCTGAGTGGGG - Intergenic
1133202529 16:4212858-4212880 GAGGAGAGAGGGACTGAGCCTGG - Intronic
1133451697 16:5909452-5909474 AAGGAGAGATGGTCTGCTTCAGG + Intergenic
1134090766 16:11390543-11390565 GAGGAGATAGGGCCTGTTCCTGG + Intronic
1134091142 16:11392297-11392319 GAGGTGAGAGGGCCTGGGCTGGG - Exonic
1135283922 16:21176804-21176826 GAGGGAGGATGGCCTGAGCCTGG + Intronic
1135691387 16:24540136-24540158 GAGGGGAGAGGGCCTAGGCCCGG - Intronic
1135873432 16:26173805-26173827 GAGGGCAGATGGCTTGAGCCAGG + Intergenic
1135976684 16:27113125-27113147 CAGGAGAGATCCACTGCGCCTGG + Intergenic
1136381453 16:29897945-29897967 GAGGAGATATTGCCAGAGCCTGG - Exonic
1139577494 16:67851094-67851116 GAGAAGAGATGGGCTCGGCCAGG - Intronic
1139758355 16:69163464-69163486 GAGGAGAGATGACATGGGCTTGG + Intronic
1141598538 16:85111958-85111980 GAGCAGGGATGGCATGGGCCGGG + Intronic
1142761459 17:2044420-2044442 GAGGATGGATGGCTTGAGCCCGG - Intergenic
1143443728 17:6995548-6995570 GAGGACACATGGGCCGCGCCGGG + Intronic
1143712865 17:8745918-8745940 GAGAAGAGGGAGCCTGCGCCTGG - Intergenic
1143735667 17:8910568-8910590 GAGGATAAGTGGCCTGCGCAGGG + Intronic
1145067545 17:19772085-19772107 GTGCAGAGATGGCCAGAGCCAGG - Intronic
1145906442 17:28518831-28518853 GAGAAGAAATGACCTGCGCAGGG - Intronic
1146646015 17:34578192-34578214 GAGGAGAGCTGGCCAGCTCTTGG - Intronic
1146662659 17:34674953-34674975 GAGGAGAAGTGGCCTTCCCCAGG + Intergenic
1147228575 17:39000695-39000717 GAGGGGAGATGGCTTCCCCCAGG - Intergenic
1147628173 17:41913429-41913451 GAGGTGAAATGGCTTGCCCCAGG + Intronic
1148751076 17:49946268-49946290 GAGGGGAGATGCCCTCCACCAGG - Intergenic
1149461857 17:56834802-56834824 GCGGAGAGGCGGCCGGCGCCGGG + Exonic
1149649871 17:58269991-58270013 GGGGAGCCATGGCCTGAGCCTGG + Exonic
1150816335 17:68395103-68395125 GAGGTAAGCTGGCCTGGGCCAGG - Exonic
1151408089 17:73902421-73902443 GAAGAGAGGTGGCCTGCTCAAGG + Intergenic
1151546194 17:74794666-74794688 GAGGAGAGATGTCCCGAGTCAGG - Intronic
1151691708 17:75690480-75690502 GAGGAGAGATCACCTGAGTCTGG - Intronic
1152217164 17:79040369-79040391 GTGGGCAGATGGCCTGAGCCGGG + Intronic
1152460806 17:80441426-80441448 TGGGAGAGATGGCCTGGGCTGGG - Intergenic
1152556731 17:81056967-81056989 GAGGAATGAAGGCCTGTGCCTGG - Intronic
1152568677 17:81111737-81111759 GAGGGCAGAGGGCCTGCTCCTGG - Intronic
1153489154 18:5630121-5630143 GGGGACAGAGGGCTTGCGCCCGG - Intronic
1157109849 18:44810270-44810292 CAGGAAGGAGGGCCTGCGCCAGG - Intronic
1159943529 18:74426722-74426744 GAGGAGAGTGGGGCTGGGCCAGG + Intergenic
1161164854 19:2780987-2781009 GAGGTGGGAGGGCCTGAGCCTGG + Intronic
1162013791 19:7832747-7832769 GATGAGAGATGGTCTGCTGCAGG + Intronic
1162118358 19:8445534-8445556 GAGGAGAGAGGGTGCGCGCCCGG + Intronic
1162396051 19:10418672-10418694 GAGGAGCGGTGGCCTGAGCTGGG - Intronic
1162813772 19:13180971-13180993 GAGGATAGATGGGCTGAGGCAGG + Intergenic
1163064504 19:14783387-14783409 CAGGAGTGATGGCATGTGCCTGG + Intergenic
1163677088 19:18660610-18660632 GAGGAGGGAGGGCCGGGGCCAGG - Intronic
1164492411 19:28727390-28727412 GCAGAGAGTTGGGCTGCGCCAGG - Intergenic
1164500339 19:28814444-28814466 GAGGAGAGAGGGACTGGGCATGG - Intergenic
1165027138 19:32970175-32970197 CTGGAGAGTTGGCCTGGGCCTGG - Intronic
1165371129 19:35406862-35406884 GTGGAGAGATGGTCAGGGCCTGG + Intergenic
1166323988 19:42037965-42037987 GAGGTGTGATGGCGTGCCCCTGG - Intronic
1166932234 19:46308419-46308441 GAGGAGAGATGGCCCTGCCCTGG + Intronic
1167015851 19:46840544-46840566 GTGGGGAGATGACCTGAGCCTGG + Intronic
1167926309 19:52823832-52823854 GAGGACAGATGGCCTGAGGTCGG + Intronic
925238565 2:2300798-2300820 GAAGAGAGATGCCCAGCTCCAGG - Intronic
926135654 2:10334027-10334049 GAGGAGAGATGGGCTTGGGCTGG - Intronic
926169957 2:10546807-10546829 GGAGAGAGAAAGCCTGCGCCTGG - Intergenic
927509290 2:23634455-23634477 CAGAAGAGATGGGCTGGGCCTGG - Intronic
927863269 2:26573642-26573664 GAGGAGACCTGGCCTCCGCGGGG + Intronic
928695217 2:33842114-33842136 GAGGAGAGTTGGACTTCACCAGG - Intergenic
930672328 2:54164189-54164211 GAAGAGAGATGGCATGGGTCAGG + Intronic
932090246 2:68799879-68799901 GAGGAGGGAAGGCCTGAGGCTGG + Intronic
932970289 2:76532714-76532736 GTGGGGGGATGGCCTGAGCCTGG + Intergenic
934091244 2:88552516-88552538 GAGGTCAGAGGGCCTGAGCCAGG - Intergenic
935065661 2:99645232-99645254 GAGCTGAGATGGCTTGAGCCTGG + Intronic
937060666 2:118978203-118978225 GAGGAGAGTGGGCCTGCACTGGG + Intronic
938408596 2:131046128-131046150 GAAGGTAGATGGCTTGCGCCTGG - Exonic
940840224 2:158571455-158571477 GAGGAGAGATGGTGTGCTCCTGG - Intronic
941125545 2:161579741-161579763 GTGGAGAGATCACCTGGGCCTGG - Intronic
942357276 2:175130772-175130794 GAGGAGAGATTCCCTGAGGCTGG - Intronic
943390955 2:187267296-187267318 GAGAGGAGCTGGCCTGCTCCAGG + Intergenic
945057309 2:205880236-205880258 GCGGGGAGATCGCCTGAGCCTGG + Intergenic
945175926 2:207043178-207043200 GAGGAAAGATGTCATGCCCCTGG - Intergenic
947265419 2:228274323-228274345 GGGCAAAGATGGCCTGTGCCTGG + Intergenic
947611045 2:231525327-231525349 GTGGACAGATGGCCTGCACCTGG - Exonic
947671154 2:231936411-231936433 TGGGAGAAATGGCCTGAGCCAGG - Intergenic
1168764097 20:370188-370210 GAGGGAGGATGGCCTGAGCCAGG - Intronic
1169243124 20:4001852-4001874 GTGGAGAGATTGCTTGAGCCTGG + Intronic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1174040255 20:47694354-47694376 GGGTAGAGAAGGCCTGGGCCGGG + Intronic
1174634898 20:51990534-51990556 GAGGTTAGATGGCCTGCCCAAGG - Intergenic
1175516108 20:59571355-59571377 GAAGAGCTATGGCCTGTGCCGGG - Intergenic
1176955439 21:15097487-15097509 GAGGCGAGATCGCTTGAGCCAGG + Intergenic
1180606299 22:17061537-17061559 GAGATGAGATGGCCTTGGCCTGG + Intergenic
1180613575 22:17113285-17113307 GTGGAAAGATGGCTTGAGCCTGG - Exonic
1181045334 22:20211591-20211613 GAGGAGAGGTGGGCTGTGGCTGG + Intergenic
1181084751 22:20434618-20434640 GGGGAAAGATGGCCTGCTGCAGG + Intronic
1181347092 22:22227552-22227574 GAGGTGGGATGGCCTGAGCCTGG - Intergenic
1181517564 22:23423955-23423977 TTGGGGAGATGGCCTGGGCCCGG + Intergenic
1181673669 22:24438092-24438114 CAGGAGAGATGGCCTGCCTCAGG - Intronic
1181863320 22:25836032-25836054 GAGAGGAGCTGGCCTGCCCCAGG + Intronic
1183398939 22:37589764-37589786 GAGCAGAGAATGCCTGCTCCAGG - Intergenic
1184655856 22:45941785-45941807 GAGGAGTGACGGCCTTGGCCAGG - Intronic
1185119507 22:48957618-48957640 GAGGACAGATGGCCTCTGCCTGG - Intergenic
949897200 3:8776765-8776787 GAGGAGAGATGGGCTGCCTAAGG - Intronic
950129208 3:10530406-10530428 GAGGGGAGACGACCTGCGGCCGG + Intronic
950385336 3:12654506-12654528 GAGGGAAGATGGCTTGTGCCTGG + Intronic
950631897 3:14287466-14287488 GAGGAGAGATGGCCTATACTTGG + Intergenic
950706920 3:14788566-14788588 GAGGTGAGATGGGCTGGGCTGGG + Intergenic
950803905 3:15580219-15580241 GAGGAAAGATTGCTTGAGCCAGG - Intronic
950881450 3:16325938-16325960 GCAGAGAGACGGCCTGCTCCAGG + Intronic
951221952 3:20078083-20078105 GAGGGAGGATGGCCTGAGCCTGG + Intronic
951858768 3:27227255-27227277 GAGGAGGGGTGGCCTTCACCAGG + Intronic
952150232 3:30581233-30581255 GAGGAGTGAGCGACTGCGCCTGG + Intergenic
952884206 3:38002784-38002806 GAGGGGAGGCGGCCTGGGCCTGG - Intronic
952971277 3:38651704-38651726 CAGGAGAGGTGGGCTGAGCCTGG + Intergenic
953099358 3:39809844-39809866 GAGGCGCGGTGGCCTGAGCCCGG + Exonic
953535423 3:43773612-43773634 GAGGAGAGAATGCCTGGGCTGGG - Intergenic
953617616 3:44505472-44505494 GTGGGAAGATGGCCTGGGCCTGG + Intronic
954130655 3:48559080-48559102 GAGGACAGCTGGCCTGGGCAGGG + Intronic
954288992 3:49639024-49639046 GAGTAGAAATGGCCTGCTCTGGG + Intronic
954378107 3:50205428-50205450 GAGGAGAGCTGCCCAGAGCCCGG - Intronic
954482829 3:50817383-50817405 GAGGACAAATGGCTTGAGCCTGG - Intronic
954590708 3:51779073-51779095 GAGGAAAGAAGGCCTGGCCCAGG + Intronic
959849619 3:111071612-111071634 GAGGAGACAGGGCTTGCGCCCGG + Intronic
961129096 3:124448721-124448743 GAGGAGAGATGGTCTGTGCCAGG - Intronic
962923461 3:139971533-139971555 GAGGAGGTATGGCCTGAGACAGG + Intronic
964105678 3:153036781-153036803 GTGGAAAGATGGCTTGAGCCTGG + Intergenic
964616355 3:158670838-158670860 GTGGGAAGATGGCCTGAGCCCGG + Intronic
965609649 3:170530877-170530899 GAGGAGAGAGGCCCTGCGGCAGG + Intronic
967634419 3:191784437-191784459 GAGTAGAGAGGCCCTGGGCCTGG + Intergenic
968336499 3:197918023-197918045 GAGGAGAAATGGGCTGGGCATGG - Intronic
968599706 4:1503205-1503227 GGGGAGAGCTGGCCTGCCCACGG + Intergenic
968642061 4:1719934-1719956 GAGGACAGATGGCCAGTGGCTGG - Intronic
968748342 4:2372634-2372656 GATGAGGGAGGGCCTGCGGCTGG + Intronic
968952126 4:3700698-3700720 GAGGTGAGCTGGCCTAGGCCAGG + Intergenic
969803246 4:9586288-9586310 CAGGCGTGATGCCCTGCGCCCGG + Intergenic
975430641 4:74286795-74286817 GAGGAGAGATGGCAGGCAACAGG - Intronic
976751836 4:88457214-88457236 GAGGAGAGAACGCCTGGTCCCGG - Exonic
977137073 4:93318759-93318781 GAGGAGATATGGCATAAGCCTGG - Intronic
977554633 4:98476348-98476370 GAGGAGCTTTGGCCTGTGCCTGG - Intronic
978193668 4:105945651-105945673 GGGGAGAGATGGCTTGGGCCAGG - Intronic
978902598 4:113970662-113970684 GAGGAGAGAGGGGCTGGGCAAGG + Intronic
986170430 5:5310325-5310347 GAGGAGAGATGACCAGTGGCGGG - Intronic
987289520 5:16495464-16495486 GGGAAGAGGTGGCCTGGGCCTGG - Intronic
991464693 5:66898150-66898172 TAGGAGAAATGGCCTGAGTCTGG + Intronic
992707708 5:79414174-79414196 GTGGAAAGATTGCCTGAGCCTGG - Intronic
992711862 5:79466402-79466424 CAGGAGAGATCACCTGAGCCAGG + Intronic
993122459 5:83793301-83793323 GTGGGAAGATGGCCTGAGCCCGG - Intergenic
994484848 5:100378984-100379006 GAAGAAAGATGACCTGAGCCTGG + Intergenic
998440327 5:142155438-142155460 GAGGTGGGATGGCTTGAGCCTGG - Intergenic
1001080739 5:168665486-168665508 GAGGAGAGAGGGCCAGTGCATGG + Intronic
1001342823 5:170862583-170862605 GAGGAGACAGGGGCTGCGTCTGG + Intronic
1002048596 5:176556114-176556136 TATGAGAGATGGCCTGGGCCAGG - Intronic
1002065318 5:176648708-176648730 GAGGAGAGATGACTTGCCCAAGG - Intronic
1002078413 5:176723440-176723462 GAGTGGAAAAGGCCTGCGCCTGG - Intergenic
1002199216 5:177517627-177517649 GAGGAGAGGCGTCCTGGGCCAGG + Intergenic
1002199310 5:177518350-177518372 GAGGAGAGGCGTCCTGGGCCAGG + Intergenic
1002435321 5:179227787-179227809 GAGGAGAGATGGCCGAGGCCGGG + Intronic
1003600445 6:7512069-7512091 GTGGGAAGATGGCCTGAGCCTGG + Intergenic
1005993223 6:30916190-30916212 GAGGAGACATGAGCTGAGCCGGG + Exonic
1006848836 6:37082606-37082628 GAGGTGAGATCGCTTGAGCCTGG + Intergenic
1007234876 6:40383521-40383543 GGGGAGAGCTGGGGTGCGCCAGG - Intergenic
1008608422 6:53163605-53163627 GAGGAGAGATTGCTTGAGCAAGG - Intergenic
1010237695 6:73589073-73589095 GTGGATAGATGGCTTGAGCCCGG - Intergenic
1012111871 6:95245456-95245478 GAGGAGGGATTGCCTGAGTCTGG - Intergenic
1015616246 6:135078398-135078420 CAGGAGACATGGCCTCTGCCAGG - Intronic
1015817091 6:137221784-137221806 GTGGAAGGATGGCTTGCGCCCGG - Intergenic
1016383728 6:143511637-143511659 GAGGACAGCCGGCCTGCGCCGGG - Exonic
1016551323 6:145283410-145283432 GAGGAGAAAAGGCCTGGGCGTGG + Intergenic
1018734613 6:166678294-166678316 GATGAGAGATGTTCTGAGCCAGG - Intronic
1019997217 7:4732384-4732406 GAGGGAAGATGGCTTGAGCCTGG - Intronic
1021315540 7:19144148-19144170 GAAGAGAGAGGGCTTGCGCGCGG + Intergenic
1022532375 7:31075130-31075152 AAGGTGAGATGGCCTGGGGCAGG - Intronic
1023382724 7:39624051-39624073 GCGGAGAGGTCCCCTGCGCCCGG + Intronic
1023458498 7:40367871-40367893 GAGGACAGATGGCAAGGGCCAGG - Intronic
1028484769 7:91345687-91345709 AAGGAGAAATGGCCTCCTCCGGG + Intergenic
1032240396 7:130154783-130154805 GAGGCCAGATGGCCTGGTCCCGG - Intergenic
1032473001 7:132191744-132191766 GAGGAGGGATGACATTCGCCAGG - Intronic
1033448450 7:141441771-141441793 GAAGGAAGATGGCCTGCGCTGGG + Intronic
1035073128 7:156159298-156159320 CAGGAGAGATGGCGGGCCCCTGG + Intergenic
1037590550 8:20308380-20308402 GAGGAGAGATGGTCCTGGCCAGG - Intergenic
1037744266 8:21630511-21630533 GGGGAGAGATGGCTTCCCCCAGG - Intergenic
1037853299 8:22350501-22350523 CAGGAGGGATGGCTTGAGCCTGG + Intronic
1037959600 8:23086059-23086081 GAGGGGAGGTGACCTGTGCCAGG - Intronic
1038052555 8:23827438-23827460 GAGGAGGGGTGGCCTGGCCCAGG + Intergenic
1039571168 8:38587509-38587531 GTGGAAAGATTGCCTGAGCCTGG + Intergenic
1042053699 8:64739125-64739147 TAGGAGAAATGCCCTGTGCCTGG - Intronic
1044024256 8:87149273-87149295 GAGGAGAGATGGGCCTCCCCTGG + Intronic
1045320007 8:101075242-101075264 GAGGTGAAATGGCCTGCCCCAGG - Intergenic
1048278465 8:133086174-133086196 GATTAGTGATGGCCTGCGGCTGG + Intronic
1049513165 8:143039838-143039860 GAGAAGAGGTGGGGTGCGCCTGG + Intronic
1049929190 9:439690-439712 GAGGTGAAATGGCCTGCCCAGGG + Intronic
1053475016 9:38376502-38376524 GAGGAGAGTGGGCCTGCAGCAGG + Intergenic
1056766379 9:89447032-89447054 TGGGAGAGATGGTCTGGGCCTGG - Intronic
1057712045 9:97454385-97454407 GAGGAAAAATGGCGTGCACCAGG + Intronic
1057817051 9:98303605-98303627 GAGGGGAGGGGGCCTGCCCCAGG - Intronic
1058142083 9:101367576-101367598 GAGGAAAGATCGCTTGAGCCTGG - Intronic
1060401893 9:123354284-123354306 GAGGAGACTGGACCTGCGCCGGG + Intergenic
1060742064 9:126105512-126105534 GTGGAGAGGTGTCCTGGGCCTGG - Intergenic
1061053628 9:128210137-128210159 GAGGATGGATGGCTTGAGCCCGG - Intronic
1061165214 9:128918418-128918440 GAGGTGAGATCACCTGAGCCTGG - Intergenic
1061369446 9:130189986-130190008 CAGGAAAGATGGCTTGAGCCAGG + Intronic
1062069024 9:134545413-134545435 GATAAGAGATGGCCTGCTTCTGG - Intergenic
1062264095 9:135678902-135678924 GGGGAGAGAAGGCCTGGGCCTGG - Intergenic
1062389150 9:136327297-136327319 CAGGGGAGAGGGCCTGGGCCTGG - Intergenic
1185628684 X:1500723-1500745 CAGGCGAGAGGCCCTGCGCCCGG + Intronic
1185759788 X:2681597-2681619 CAGGAGAGTTGGTCTGGGCCTGG + Intergenic
1193043164 X:77024829-77024851 GAGCAGGGATGTCCTGGGCCTGG + Intergenic
1195113419 X:101670044-101670066 GAAGAGAGATGGCCTGGGCAAGG - Intergenic
1195116775 X:101707175-101707197 GAAGGGAGATGGCCTGGGCAAGG + Intergenic
1195376347 X:104231597-104231619 TAGGAGGGATCGCCTGAGCCCGG - Intergenic
1197465872 X:126804016-126804038 CAGGAGAAATGGCATGAGCCTGG + Intergenic
1202379581 Y:24263516-24263538 GGGCAGAGGTGGCCTGGGCCTGG + Intergenic
1202491201 Y:25406605-25406627 GGGCAGAGGTGGCCTGGGCCTGG - Intergenic