ID: 911198700

View in Genome Browser
Species Human (GRCh38)
Location 1:95021963-95021985
Sequence GCTCATTTTGGATCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911198700_911198707 19 Left 911198700 1:95021963-95021985 CCAGCCTCAGATCCAAAATGAGC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 911198707 1:95022005-95022027 TGACAACTCAAGAGTGATGCAGG 0: 1
1: 0
2: 1
3: 9
4: 153
911198700_911198705 -9 Left 911198700 1:95021963-95021985 CCAGCCTCAGATCCAAAATGAGC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 911198705 1:95021977-95021999 AAAATGAGCCTGTGATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911198700 Original CRISPR GCTCATTTTGGATCTGAGGC TGG (reversed) Intronic
901934240 1:12616923-12616945 GCTCCTTTGGGATCGGTGGCTGG - Intronic
903177452 1:21589529-21589551 CCTCATTTTGTTGCTGAGGCTGG - Intergenic
903910212 1:26718763-26718785 CTACATTTTTGATCTGAGGCTGG + Intronic
907637796 1:56153675-56153697 CCTCATCTTGGCTCTAAGGCCGG - Intergenic
907643770 1:56219874-56219896 TCTCATTTTGTAACTTAGGCTGG - Intergenic
909093936 1:71263506-71263528 ACTCAGTTTCGAGCTGAGGCAGG + Intergenic
909936908 1:81561838-81561860 GCTCATTTTAGATCTGGGCCAGG - Intronic
911189791 1:94936351-94936373 GCTCATTCTGGACATGAGGAAGG + Intergenic
911198700 1:95021963-95021985 GCTCATTTTGGATCTGAGGCTGG - Intronic
913613980 1:120537850-120537872 GCTGATTCTGGGACTGAGGCAGG + Intergenic
914373173 1:147049403-147049425 GCTGATTCTGGGACTGAGGCAGG + Intergenic
914576287 1:148973043-148973065 GCTGATTCTGGGACTGAGGCAGG - Intronic
914846530 1:151286781-151286803 GCTCATTTTGGCCCTGAGCCAGG + Exonic
915097589 1:153474344-153474366 GGTCTTGTTGGGTCTGAGGCTGG - Intergenic
915839388 1:159202630-159202652 GGGCATCCTGGATCTGAGGCGGG - Intronic
916547867 1:165823284-165823306 GCTACTTTGGGAGCTGAGGCAGG + Intronic
917159764 1:172044366-172044388 GCTCATTTTGCATCTGCAGATGG + Exonic
918190308 1:182167607-182167629 TCTCATTCTGTCTCTGAGGCTGG + Intergenic
921093798 1:211869207-211869229 GCTGATTCTAGGTCTGAGGCAGG - Intergenic
924745337 1:246827991-246828013 GCTCTTTTGGGAGCTGAGGCGGG + Intergenic
1062871683 10:910045-910067 GCTCAGCATGGATCTGGGGCGGG - Intronic
1063456174 10:6184297-6184319 GCACTTTGTGGAGCTGAGGCAGG - Intronic
1064822127 10:19349071-19349093 GCTCCTTAGGCATCTGAGGCAGG - Intronic
1066424071 10:35289760-35289782 GCTACTTGGGGATCTGAGGCAGG + Intronic
1069144050 10:64866891-64866913 GCTGATTCCGCATCTGAGGCAGG - Intergenic
1069787474 10:70998045-70998067 GCTCTTGTTGGATTTGAGGAAGG + Intergenic
1070819398 10:79346190-79346212 GCCCATTCAGGATCTGGGGCAGG + Intergenic
1072447473 10:95512111-95512133 GGTCATTTTTGATCAGACGCTGG - Intronic
1073098462 10:100994899-100994921 TCTCATTCTGGATTTGAGGACGG + Intergenic
1073969621 10:109032346-109032368 GCTGATGATGGATCTGAGGCAGG - Intergenic
1074716606 10:116225699-116225721 GCTCCTTGGGGAGCTGAGGCAGG - Intronic
1077359363 11:2133898-2133920 GCCCATTTTTCATCTGAGGAAGG - Intronic
1077701466 11:4445856-4445878 TCTCAGTTTGGATCAGAGGGTGG + Intergenic
1078469826 11:11577964-11577986 TCACATTTTGGAGCTGAGGCTGG - Intronic
1078574283 11:12485398-12485420 GCTAATTTTAGACCTGGGGCAGG + Intronic
1078844815 11:15111329-15111351 GAACAATTTGGAGCTGAGGCTGG + Intergenic
1079251216 11:18789600-18789622 GCTCATCATGGAGCTGAGCCAGG - Intronic
1081019285 11:37923657-37923679 GCTCATTTTGGCTGTGGGACAGG - Intergenic
1083435950 11:62643389-62643411 GCTCTTTGTGAAGCTGAGGCGGG + Intronic
1083471604 11:62887989-62888011 GCTCATTATGTTGCTGAGGCTGG + Intronic
1084723617 11:70925811-70925833 GCTAATTTTGTATTTGTGGCAGG - Intronic
1084934421 11:72579353-72579375 GCGCATGCTGGATCTGATGCGGG - Exonic
1087638040 11:100725544-100725566 GCACTTTTCGGAGCTGAGGCAGG + Intronic
1089094078 11:115903821-115903843 GTTCATTTTGGAACTAAGGGTGG + Intergenic
1092940654 12:13404303-13404325 CCTCATTTTGGAGCTGTGCCTGG - Intergenic
1095369550 12:41450673-41450695 GCACTTTTGGGAGCTGAGGCGGG + Intronic
1100576650 12:95897840-95897862 GCTCCTTTGGAAGCTGAGGCGGG - Intronic
1102683506 12:114706256-114706278 GCTGATTTTGGCTCAGAGACAGG + Intergenic
1103291819 12:119852588-119852610 GCTACTTGTGGAGCTGAGGCAGG + Intronic
1108646242 13:52431816-52431838 GTTGATTCCGGATCTGAGGCAGG + Intronic
1108848163 13:54699787-54699809 GCTCATCTGGGATCTGTGGAAGG - Intergenic
1109744189 13:66599734-66599756 GCACTTTTTGAAGCTGAGGCAGG - Intronic
1111274953 13:85936130-85936152 GCTCATTCAGGATCTGCGGAAGG + Intergenic
1114187952 14:20417410-20417432 GCTACTTCTGGAGCTGAGGCAGG + Intergenic
1114913620 14:27232947-27232969 GCTACTTGGGGATCTGAGGCAGG + Intergenic
1115495836 14:34003723-34003745 GCTCAGTTTGGATGTGTTGCAGG + Intronic
1117300089 14:54416701-54416723 GCTCCTTGTGGGACTGAGGCTGG + Intronic
1120174752 14:81281094-81281116 GCTCATTTTGTTTCTGGGGTGGG - Intronic
1120743909 14:88136889-88136911 ACACAATTTGGATCGGAGGCAGG + Intergenic
1122263223 14:100534935-100534957 GCTCCTTGTGGTGCTGAGGCTGG - Intergenic
1122461928 14:101903219-101903241 GCTAATTTTGCATCTGGGGAAGG - Intronic
1124102924 15:26712621-26712643 GGTCATTTAGGATGTGAGTCTGG + Intronic
1124853354 15:33362253-33362275 GTTCATTTTGGATCACAGGGAGG - Intronic
1125340533 15:38671234-38671256 TCCCATTCTGGATCTGAGGGTGG + Intergenic
1126049656 15:44674365-44674387 GCTGACTTTGAATCTGAGGGAGG - Intronic
1127962836 15:63902659-63902681 TCTCATTTTGGAATTGAGCCAGG - Intergenic
1132594627 16:742797-742819 GCACATTGTGGGGCTGAGGCAGG + Intronic
1133434834 16:5770167-5770189 TCTCATGTTGGACCTGAGGTAGG + Intergenic
1133580984 16:7144534-7144556 GCTCTTTTTGCGGCTGAGGCAGG - Intronic
1137265349 16:46864670-46864692 GATCATTTTCTATATGAGGCTGG - Intergenic
1140429577 16:74890395-74890417 GCACTTTTTGGGGCTGAGGCAGG - Intronic
1141347327 16:83259121-83259143 GCTCATGGTGGATGGGAGGCCGG + Intronic
1145371966 17:22314123-22314145 GCACATTGTGGAGCTGAGGTAGG + Intergenic
1148170519 17:45515752-45515774 GCTCTCTCTGCATCTGAGGCAGG - Intergenic
1148170996 17:45519745-45519767 GCTCTCTCTGCATCTGAGGCAGG - Intergenic
1148278684 17:46330060-46330082 GCTCTCTCTGCATCTGAGGCAGG + Intronic
1148300894 17:46547922-46547944 GCTCTCTCTGCATCTGAGGCAGG + Intronic
1148365024 17:47048807-47048829 GCTCTCTCTGCATCTGAGGCAGG + Intergenic
1149468289 17:56896637-56896659 TCTCATTTTGTTGCTGAGGCTGG - Intronic
1150275987 17:63898236-63898258 TCTCATTCTGTCTCTGAGGCTGG + Intergenic
1150401609 17:64861341-64861363 GCTCTCTCTGCATCTGAGGCAGG - Intronic
1150781720 17:68128648-68128670 GCTCTCTCTGCATCTGAGGCAGG - Intergenic
1151976673 17:77487460-77487482 GCTGATTTTGGATTTGAAGAGGG - Exonic
1153109249 18:1564402-1564424 GCTCATTTTGTTTCTCAGCCTGG - Intergenic
1153664684 18:7358355-7358377 GCTAATTTGGAAGCTGAGGCAGG + Intergenic
1153964873 18:10170262-10170284 GCTCATTTTGCAGATGAGGGAGG + Intergenic
1155224185 18:23714051-23714073 CCTCACCTTGGATCTGGGGCAGG + Exonic
1157027569 18:43864349-43864371 GATCATTTTGTATCTCTGGCTGG - Intergenic
1158206849 18:55002580-55002602 TCTCATTTTGTCACTGAGGCTGG - Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163055778 19:14716503-14716525 GCACATTGTGGGGCTGAGGCAGG - Intronic
1163521405 19:17794167-17794189 GCACCTTGGGGATCTGAGGCAGG + Intergenic
1163916536 19:20245245-20245267 GCTCATTTAGGACCTAAGACTGG + Intergenic
1164556624 19:29257750-29257772 GCTAATTTGGAAGCTGAGGCAGG + Intergenic
1165244743 19:34492222-34492244 ACTCATTGTGGGGCTGAGGCAGG - Intronic
1167665772 19:50822173-50822195 GGTCATTTGGGGTCTGGGGCTGG + Intronic
926010225 2:9401000-9401022 GCCCATTGTGGAGCTGCGGCAGG - Intronic
926967259 2:18428793-18428815 GCTCATTTTAGATCTCAGTGAGG - Intergenic
926999893 2:18783649-18783671 TCTCCTCTTGGACCTGAGGCTGG - Intergenic
930241682 2:48942023-48942045 GCTAATTTTGGATCTGGAGTAGG - Intergenic
934889695 2:98056462-98056484 GCTACTTTGGAATCTGAGGCAGG - Intergenic
935831061 2:107000924-107000946 GCTGATTTGGGATCTGAAGCAGG + Intergenic
936249821 2:110859789-110859811 GCTCACCTTGCATCTGAGGGTGG + Intronic
936651278 2:114429254-114429276 ACTCTTTTTGGCTCTCAGGCCGG - Intergenic
938487254 2:131723749-131723771 GGCCATCTTGGACCTGAGGCGGG + Intronic
940739944 2:157495833-157495855 AATTATTTTTGATCTGAGGCTGG - Intergenic
941375173 2:164719660-164719682 ACTCATATTGGATTTGAGGTGGG - Intronic
945136497 2:206634468-206634490 CCCCTTTTTGAATCTGAGGCTGG - Intergenic
945740255 2:213651237-213651259 GCTGATTTTGGATTTGATACTGG + Intronic
948141259 2:235673427-235673449 GGAAATTTTGGATCTGAGGAAGG + Intronic
948764949 2:240214847-240214869 GCCCATGGTGGATCTGAGCCGGG + Intergenic
1169218945 20:3809899-3809921 TCTCATTTTGTTGCTGAGGCTGG + Intergenic
1169717460 20:8636429-8636451 GCACATTTTGGATATGTGTCAGG + Intronic
1173138933 20:40465134-40465156 GCTCAGTTTGGTTCCGAGGAAGG + Intergenic
1174855333 20:54039625-54039647 GCTCATGTTGGAGCAAAGGCTGG - Intronic
1175558732 20:59897990-59898012 GCTCCTTGGGAATCTGAGGCAGG + Intronic
1175676579 20:60951291-60951313 GCTCATTTTGGCTCAGTGGCTGG + Intergenic
1177405703 21:20664841-20664863 GTTCATTTTTGAGCAGAGGCTGG + Intergenic
1179419766 21:41226028-41226050 GCTCAGTGTGTATCTGAGACAGG + Intronic
1181004043 22:20001248-20001270 CCTCATGTGGGATCAGAGGCAGG - Intronic
1181869904 22:25889752-25889774 GCTCATTTGGCATCGGTGGCTGG + Intronic
952582704 3:34853326-34853348 GCTCATATAAAATCTGAGGCAGG - Intergenic
954101318 3:48374797-48374819 TCTCATTTTGTCTCCGAGGCTGG + Intronic
955785288 3:62531652-62531674 GCGACTTTTGCATCTGAGGCTGG + Intronic
959577624 3:107951398-107951420 GTTCACTTTGGATTTGAGGAAGG - Intergenic
959577705 3:107952183-107952205 GTTCACTTTGGATTTGAGGGAGG - Intergenic
959974577 3:112444282-112444304 TCTCACTTTGGATCTGTGACAGG - Intergenic
960729893 3:120715290-120715312 GCACATTTGGAGTCTGAGGCAGG + Intronic
962399248 3:135043086-135043108 GCTCTTTGGGAATCTGAGGCAGG - Intronic
963183209 3:142382607-142382629 GCTGATTCTGGATCTGGGGCAGG - Intronic
963945143 3:151137411-151137433 GCTCTTTGGAGATCTGAGGCAGG - Intronic
964734618 3:159903748-159903770 TCTCACTTTGTAGCTGAGGCTGG + Intergenic
967438855 3:189483033-189483055 GCTCATTCTGGGTCTGAGAAGGG + Intergenic
969077405 4:4590941-4590963 TTTCATTTGGGATTTGAGGCTGG - Intergenic
971408270 4:26342615-26342637 GCAGATTATAGATCTGAGGCAGG + Intronic
971946247 4:33282099-33282121 GCTGATTTTATATCTGTGGCGGG + Intergenic
972082175 4:35166591-35166613 ACTCATTCTGGATCTTAGCCAGG - Intergenic
973694339 4:53475463-53475485 GTTAATTTTGTATTTGAGGCAGG + Intronic
974036600 4:56823081-56823103 TCTCATTTTGCCACTGAGGCTGG - Intergenic
974408951 4:61513859-61513881 GTTAATTTTGGCTCTGAGGCAGG - Intronic
975866775 4:78731988-78732010 GAACATTTTCAATCTGAGGCTGG + Intergenic
976005332 4:80423467-80423489 CCTCATTTTGTTCCTGAGGCTGG + Intronic
976717279 4:88136388-88136410 GCTGATTCTAGGTCTGAGGCAGG + Intronic
977327056 4:95587348-95587370 TCTCATTTTGGAAAAGAGGCAGG - Intergenic
977570330 4:98622321-98622343 GCACTTTGGGGATCTGAGGCGGG - Intronic
980467433 4:133203885-133203907 GGTCATTTTGACTGTGAGGCAGG + Intronic
982740878 4:159055596-159055618 GCTAATTGAGGAGCTGAGGCTGG + Intergenic
983363099 4:166752134-166752156 GCTACTTGGGGATCTGAGGCAGG - Intronic
983598009 4:169492604-169492626 TCTCAGTTTGGATCAGAGGTGGG - Intronic
983909707 4:173224357-173224379 GTTGATTTGGGGTCTGAGGCAGG - Intronic
986808942 5:11335612-11335634 GCTCTTTTAGGAACTGAGGCAGG + Intronic
988683088 5:33502571-33502593 GGCCATCTTGGACCTGAGGCCGG - Intergenic
990197369 5:53333919-53333941 ACTCGTTTTGGACCTCAGGCTGG - Intergenic
990907079 5:60815677-60815699 GCTATTTTTGAAGCTGAGGCAGG - Intronic
992827848 5:80568302-80568324 GCTCTGTGTGAATCTGAGGCAGG - Intronic
995320021 5:110823876-110823898 GCTCATCTGGGATCTGAGGTAGG + Intergenic
996985655 5:129560465-129560487 GAACATTTTGGATCTGAGATTGG + Intronic
998821010 5:146057829-146057851 GCTACTTTTGGGGCTGAGGCAGG + Intronic
999882303 5:155879402-155879424 CATCATTTTGGCTCTGAGGGTGG - Intronic
1000002384 5:157151357-157151379 GTTCATCTTGGACCTGAAGCAGG - Intronic
1000136416 5:158356738-158356760 ACCCAGTATGGATCTGAGGCCGG + Intergenic
1000847294 5:166297645-166297667 GCTTATTTTAGGTCTGGGGCAGG + Intergenic
1001976267 5:176002218-176002240 GCTGATTTTAGGACTGAGGCAGG - Intronic
1002241155 5:177841553-177841575 GCTGATTTTAGGACTGAGGCAGG + Intergenic
1002472610 5:179445507-179445529 TCTCACTTTGTCTCTGAGGCTGG - Intergenic
1005811313 6:29518536-29518558 GCAGATTTTGTATCTAAGGCAGG - Intergenic
1006008624 6:31023287-31023309 GCACTTTTTGGGGCTGAGGCAGG + Intronic
1008036827 6:46753799-46753821 GCTCATTTTGCAGCAGAAGCAGG + Exonic
1008787106 6:55182089-55182111 GCTCATTTAACATCTGAGGTGGG + Intronic
1009553030 6:65124141-65124163 TCTCACTTTGTAACTGAGGCTGG - Intronic
1013104264 6:107013207-107013229 GCATTTTTTGCATCTGAGGCAGG - Intergenic
1016806675 6:148218910-148218932 GCTCATTTTGGATTGGAAGAGGG - Intergenic
1017504769 6:155058101-155058123 GCTTATTTTGGCACTGGGGCAGG - Intronic
1017516540 6:155161181-155161203 GCTCATTCCCGATCTGAGCCGGG + Intronic
1020017823 7:4841734-4841756 GTACATTTTGCTTCTGAGGCTGG - Intronic
1020257955 7:6512755-6512777 GCACTTTGTGGAGCTGAGGCAGG - Intronic
1020603395 7:10304996-10305018 GCTGCTTTGGGGTCTGAGGCAGG + Intergenic
1024533043 7:50409114-50409136 GCTCATATAGGCTCTGAGACTGG - Intergenic
1032112896 7:129091754-129091776 GCTCTTCTTGGATCCAAGGCAGG + Intergenic
1032263731 7:130356153-130356175 GTCCATTTTGCATCTGTGGCTGG + Intronic
1034406418 7:150905899-150905921 GCTCATCTGGGATCTGTGGAAGG - Intergenic
1035413356 7:158663986-158664008 GTTCATTTTGGAGCTCAGGTAGG - Intronic
1035671026 8:1417173-1417195 GTTCATTTAGTGTCTGAGGCGGG + Intergenic
1036416602 8:8555185-8555207 GCACATTTTGGATGTGTGGCAGG - Intergenic
1037912458 8:22751924-22751946 TCTCATTTTGGCACTGAGGCTGG + Intronic
1039945876 8:42128569-42128591 GCACACTATGGAGCTGAGGCCGG - Intergenic
1041460121 8:58102213-58102235 GCTCATTCTGTAACTGAGGCAGG - Intronic
1044871956 8:96628252-96628274 GGTCATTCTGGGTCTGGGGCTGG + Intergenic
1045861686 8:106820680-106820702 GCTCCTCATGGGTCTGAGGCAGG - Intergenic
1047367753 8:124227992-124228014 GTTCACTTTGGAACTGAGGATGG + Intergenic
1048969469 8:139636808-139636830 GGTCACCTTGGAGCTGAGGCAGG - Intronic
1049033670 8:140057888-140057910 GCTCATCCTGGATCAGACGCTGG - Intronic
1050599320 9:7234607-7234629 GCCCCTTTTGGAGCTGAGGATGG - Intergenic
1051579317 9:18653527-18653549 GCACTTTTGGGAGCTGAGGCAGG + Intronic
1051756338 9:20404935-20404957 GCTCATGGAGGATCTGAGGAAGG - Intronic
1052957536 9:34265196-34265218 TCTCACTTTGTATCTCAGGCTGG + Intronic
1053440462 9:38112085-38112107 GCTCATCTTGGGTGTTAGGCAGG - Intergenic
1056542051 9:87580293-87580315 GCTCATTTTGGGGATGTGGCTGG + Intronic
1060627690 9:125128371-125128393 GCACTTTGTGGAGCTGAGGCAGG + Intronic
1062434973 9:136542988-136543010 GCCCATTTTACATCTGAGGCTGG + Intronic
1203691629 Un_GL000214v1:47924-47946 CCTCAACTTGGATCTGAGGTTGG + Intergenic
1203644666 Un_KI270751v1:56267-56289 CCTCAACTTGGATCTGAGGTTGG - Intergenic
1185852508 X:3502183-3502205 GCTCATTTTGGAAATGAGCAGGG - Intergenic
1186219739 X:7336844-7336866 GAACATATTGGATCAGAGGCTGG + Intronic
1187806065 X:23122345-23122367 GCTCTTTCTGGGTCTCAGGCCGG + Intergenic
1189019418 X:37319034-37319056 GCTGAATTTGGATGTGAAGCTGG + Intergenic
1189432004 X:40955479-40955501 GCTGATTTCAGATCTGGGGCAGG + Intergenic
1190245936 X:48690234-48690256 GCTACTTTGGGAGCTGAGGCGGG - Intronic
1191713641 X:64178732-64178754 CCTCATTTTGGATCTTTGGTAGG - Intergenic
1193468586 X:81874333-81874355 GCTCATTAGGGATCTGTGGAAGG - Intergenic
1196339418 X:114580743-114580765 GGACATTATGGATCTGATGCTGG + Intergenic
1201578347 Y:15484595-15484617 GCACATTTTGAGGCTGAGGCAGG - Intergenic
1201589182 Y:15594976-15594998 GAACATATTGGATCAGAGGCTGG + Intergenic