ID: 911198917

View in Genome Browser
Species Human (GRCh38)
Location 1:95024265-95024287
Sequence CCGCGCCCGGCCTTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911198905_911198917 24 Left 911198905 1:95024218-95024240 CCGCCCACCTCAGCCTCCCAAAG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198906_911198917 21 Left 911198906 1:95024221-95024243 CCCACCTCAGCCTCCCAAAGTGC 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198909_911198917 17 Left 911198909 1:95024225-95024247 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198911_911198917 11 Left 911198911 1:95024231-95024253 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198913_911198917 8 Left 911198913 1:95024234-95024256 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198907_911198917 20 Left 911198907 1:95024222-95024244 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data
911198914_911198917 7 Left 911198914 1:95024235-95024257 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911198917 Original CRISPR CCGCGCCCGGCCTTTTAAAT AGG Intronic
No off target data available for this crispr