ID: 911200012

View in Genome Browser
Species Human (GRCh38)
Location 1:95034903-95034925
Sequence GGCACAGAGGGCAAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911200012_911200018 -1 Left 911200012 1:95034903-95034925 CCTCTCTCTTTGCCCTCTGTGCC No data
Right 911200018 1:95034925-95034947 CCTGTTTTGCACTGTAGGCTTGG No data
911200012_911200019 0 Left 911200012 1:95034903-95034925 CCTCTCTCTTTGCCCTCTGTGCC No data
Right 911200019 1:95034926-95034948 CTGTTTTGCACTGTAGGCTTGGG No data
911200012_911200015 -6 Left 911200012 1:95034903-95034925 CCTCTCTCTTTGCCCTCTGTGCC No data
Right 911200015 1:95034920-95034942 TGTGCCCTGTTTTGCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911200012 Original CRISPR GGCACAGAGGGCAAAGAGAG AGG (reversed) Intronic
No off target data available for this crispr