ID: 911210957

View in Genome Browser
Species Human (GRCh38)
Location 1:95137510-95137532
Sequence TGTGATTCCTTTGCAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911210957_911210969 24 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210969 1:95137557-95137579 GTGTTTTGGTGGGGAGGGGCTGG 0: 1
1: 0
2: 11
3: 115
4: 1010
911210957_911210967 19 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210967 1:95137552-95137574 TGATCGTGTTTTGGTGGGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 248
911210957_911210968 20 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210968 1:95137553-95137575 GATCGTGTTTTGGTGGGGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 228
911210957_911210962 10 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210962 1:95137543-95137565 ATGAGTGAGTGATCGTGTTTTGG No data
911210957_911210963 13 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210963 1:95137546-95137568 AGTGAGTGATCGTGTTTTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 104
911210957_911210964 14 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210964 1:95137547-95137569 GTGAGTGATCGTGTTTTGGTGGG 0: 1
1: 0
2: 1
3: 2
4: 87
911210957_911210966 18 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210966 1:95137551-95137573 GTGATCGTGTTTTGGTGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 191
911210957_911210965 15 Left 911210957 1:95137510-95137532 CCTGTATTTGCAAAGGAATCACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 911210965 1:95137548-95137570 TGAGTGATCGTGTTTTGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911210957 Original CRISPR TGTGATTCCTTTGCAAATAC AGG (reversed) Intronic
900894087 1:5470751-5470773 TCTGCTTCCTATGCATATACTGG + Intergenic
904283199 1:29435786-29435808 TGTGACTTCTTTGCACATGCTGG + Intergenic
905131326 1:35760758-35760780 TGGGTTTCCTTTGAAACTACAGG + Exonic
907126790 1:52057095-52057117 TGTTATACCTTTCCAAATGCAGG + Intronic
908359437 1:63354221-63354243 GGTGTTTACTTTTCAAATACTGG - Intergenic
909493614 1:76253085-76253107 TTTGTTTCCTATGAAAATACTGG - Intronic
910382911 1:86648650-86648672 TATGATTCATTAGCAAATACAGG - Intergenic
910557051 1:88545773-88545795 TGTGGTTAATTTCCAAATACTGG + Intergenic
911059618 1:93736584-93736606 TGTGATTCCTTTGCATAATATGG + Intronic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
911554615 1:99328578-99328600 TTTGAATCCTTTGGAAATAGAGG + Intergenic
912584040 1:110745599-110745621 TCTGATTCCTTTGGGAACACAGG + Intergenic
915354592 1:155248404-155248426 TCTGTTTCCTCTGCAGATACAGG - Exonic
917032958 1:170715065-170715087 TCTGATTCCTCTGCAAATGTAGG - Intronic
918223043 1:182453568-182453590 TGTGATGTCTTTATAAATACTGG + Intronic
920776159 1:208939285-208939307 TATTATCCCTTAGCAAATACTGG + Intergenic
921974516 1:221187443-221187465 TGTGGTTCATATGCAAAAACTGG + Intergenic
922643487 1:227260778-227260800 TGTTATTCCATTGCAGATAAGGG - Intronic
923122746 1:231008680-231008702 TGGGCTTCCTTTGCAACTAGTGG - Intergenic
1064732953 10:18351228-18351250 TATGTTTCTTTTGCAAATATAGG + Intronic
1065729254 10:28695590-28695612 TCTCATTCCTTTGTAAATACAGG + Intergenic
1066559824 10:36657995-36658017 TGTGATTTTTTTTCAAATATTGG - Intergenic
1067468181 10:46516995-46517017 AGTGACTCCTTTGCGAAAACTGG + Intergenic
1072776680 10:98203545-98203567 TGTGAGTCTTTGGTAAATACTGG + Intronic
1073931456 10:108581472-108581494 TGTGATTCCCTTGCACACAGCGG - Intergenic
1074394220 10:113084326-113084348 TGTAATTCCTTTTCAAAGGCCGG + Intronic
1076195107 10:128512207-128512229 TGTGTTGCCTTTGCAAATCTGGG + Intergenic
1076943712 10:133627998-133628020 TGTGCTGCCTGTGCAAATAGTGG + Intergenic
1079146090 11:17853360-17853382 TGTGGTGCCTTGGGAAATACAGG - Intronic
1083600433 11:63944155-63944177 TGTCATTCCTTGGAAAATAGTGG + Intronic
1086428121 11:86706947-86706969 TGTGATTCCTGGGAAAATTCTGG + Intergenic
1091288853 11:134425574-134425596 GGTGATTCCTTTGCACACAAGGG - Intergenic
1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG + Intronic
1094040078 12:26113420-26113442 TGTAATGTCTTAGCAAATACTGG + Intergenic
1094621926 12:32088150-32088172 TGTGATTTTTTTGAAAAAACAGG - Intergenic
1098670074 12:73217604-73217626 TCTGGTTCCTTTTCAAATCCAGG - Intergenic
1099893164 12:88613751-88613773 TGTTATTCCTTTGCAAAGCAGGG + Intergenic
1100597340 12:96082965-96082987 AGTCATTTCTTTGCTAATACTGG - Intergenic
1102632413 12:114292881-114292903 TGTGGATTCTTTGCAAATAAAGG + Intergenic
1104142460 12:126002024-126002046 TGTGCTTCCATTCCAAATTCTGG + Intergenic
1104367381 12:128190612-128190634 TATGATTCCTTTAGAAGTACGGG + Intergenic
1105621552 13:22072384-22072406 TTTTTTTCCTTTGCAAATGCAGG - Intergenic
1106508176 13:30390026-30390048 TGTGTTTGCTTTGCTAGTACAGG - Intergenic
1106588738 13:31079920-31079942 TGAGATTGCTTTGCAAAGAGAGG + Intergenic
1107397709 13:40034616-40034638 TGTGATTAGTTTGGAAATGCGGG + Intergenic
1110126598 13:71950999-71951021 TGTTTTTCCTTTGAAAATAAGGG + Intergenic
1110344042 13:74425334-74425356 CATGATTCCTTTTTAAATACTGG - Intergenic
1110554018 13:76838091-76838113 TGTGATTCCTTTACAATGGCAGG - Intergenic
1110951417 13:81497047-81497069 GGTTATCCCTTTCCAAATACGGG - Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1117864044 14:60126808-60126830 TGTGATGCCACTGAAAATACTGG + Intronic
1117877255 14:60266046-60266068 TTTTATTCCTTTGCCAATATTGG + Intronic
1120303122 14:82733538-82733560 TATGATCCATATGCAAATACTGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122082691 14:99276898-99276920 TGTGAGTCCTTTTCATATACGGG - Intergenic
1125041272 15:35190099-35190121 TGTGTTTCCTTTGGCAGTACTGG + Intergenic
1125821957 15:42639431-42639453 TGTGTTTCCTAACCAAATACTGG + Intronic
1127011530 15:54636045-54636067 TGTGATTCCCTGGCAATAACTGG - Intergenic
1128364028 15:66984228-66984250 TGTGATCTCTTTGCAGATGCTGG - Intergenic
1128925341 15:71650333-71650355 GGTGATTCCTATGCACATTCAGG - Intronic
1134870038 16:17644404-17644426 TGTGGTTCCTTTGCTATCACAGG + Intergenic
1136272472 16:29156593-29156615 TGTGCTTCCTTTGCTGACACCGG - Intergenic
1138111381 16:54326886-54326908 TGCGATTCCTTTCCAAGTCCAGG + Intergenic
1139236349 16:65343544-65343566 TGGGATTCATATGCAAATGCTGG + Intergenic
1140374026 16:74430322-74430344 TGTGATTTCTTTACATATTCTGG + Intergenic
1140804205 16:78518108-78518130 TGTGACTCTTATGAAAATACTGG - Intronic
1140873886 16:79132188-79132210 TATGATTGCTTTCCAAGTACAGG - Intronic
1141485044 16:84333411-84333433 TGTAATTCCTATGCAACTCCTGG + Intergenic
1144181270 17:12754753-12754775 TCTGATTCCTTTTCTAATAATGG - Intronic
1144702920 17:17350583-17350605 TGTGATTCATTTGAAAATATTGG + Intergenic
1147173645 17:38637019-38637041 AGAGAGACCTTTGCAAATACAGG + Intergenic
1148475851 17:47928105-47928127 TGTTTTTCCTTTGGAAATAAGGG - Exonic
1149014922 17:51897526-51897548 TGTGATTGCTTTGCATATTCAGG + Intronic
1149341831 17:55694870-55694892 TGTCTTTCTTTTGCAAATCCAGG - Intergenic
1155207390 18:23572304-23572326 TATAATAACTTTGCAAATACAGG - Intronic
1155580043 18:27293739-27293761 TGTAATTGCTGTGCAAATAGAGG - Intergenic
1159563160 18:70017182-70017204 TGTCATTCCAGTGCACATACTGG - Intronic
1163148430 19:15397822-15397844 TGTGTTCTCTGTGCAAATACCGG - Exonic
925323682 2:2998382-2998404 TGAGATTCATTTGAAAATAAGGG - Intergenic
927284885 2:21346469-21346491 TGTACTTCCTGTGCAAATAATGG + Intergenic
928791291 2:34957659-34957681 TGTGATTACTCTGAAAATACAGG - Intergenic
929200523 2:39230496-39230518 AGTGATTTCTATGGAAATACTGG + Intergenic
929421855 2:41798901-41798923 TGTGATCTCTTTGCATATGCTGG - Intergenic
929823909 2:45295300-45295322 TTTGATTCATTTCCAAATCCTGG - Intergenic
930519489 2:52447186-52447208 TGTGATTCCTTTAAATTTACTGG + Intergenic
931702872 2:64923251-64923273 TGTGGTTCCCTTGCACATAGTGG - Intergenic
932820597 2:74896466-74896488 TCTGTTTCCTTTCCAAATTCAGG + Intergenic
932881857 2:75509071-75509093 TGTGATGCCTGTGCAAATCGAGG + Intronic
933995614 2:87667135-87667157 TATGACTGCATTGCAAATACTGG - Intergenic
935082178 2:99808965-99808987 TTTGTTTCCTTTGCAAGCACAGG + Intronic
936298243 2:111283777-111283799 TATGACTGCATTGCAAATACTGG + Intergenic
936714496 2:115170039-115170061 TGTGATTTATTTTCAAATAATGG + Intronic
937566769 2:123301860-123301882 TGTGATATCTTTGCAAATTTTGG - Intergenic
939825568 2:147011379-147011401 TGTCATTCCATGGCAAATAGAGG + Intergenic
941238715 2:163010328-163010350 TGGTATTCCTTTGCACCTACTGG + Intergenic
944381499 2:199115947-199115969 TTTGATTCATATACAAATACAGG + Intergenic
945468367 2:210197756-210197778 AGTCATTCCTTTGTAAATGCTGG + Intronic
945931226 2:215856439-215856461 TGTGATGCATTTGCAATAACTGG - Intergenic
1169844390 20:9973936-9973958 TGTAATTTCTTTGAAAATATGGG - Intergenic
1170204669 20:13785212-13785234 TCTGTTTCCTTTTCAAATCCCGG - Exonic
1171064930 20:22005984-22006006 TGTGATTCCTTAGAAACCACTGG - Intergenic
1171086885 20:22245799-22245821 TGTGAATCATGTGGAAATACTGG + Intergenic
1171781069 20:29418157-29418179 TGTGCTGCCTGTGCAAATAGTGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174594480 20:51673015-51673037 TTTTATTCTTTTGCTAATACAGG + Intronic
1177459617 21:21394017-21394039 TGTGACTTCTTAGCACATACTGG - Intronic
1180518170 22:16168267-16168289 TTTGAGTCCTTTGCAGATTCTGG - Intergenic
1182888217 22:33794193-33794215 TGTGAATAATTTGCAAATGCTGG + Intronic
949452872 3:4206321-4206343 TGTGATTCCTGAGCAAGTTCTGG - Intronic
952263495 3:31763304-31763326 TGTCATTTCTCAGCAAATACTGG + Intronic
953190474 3:40682073-40682095 TGTAATTACCTTGCAAATCCTGG + Intergenic
956755074 3:72377604-72377626 AGTTATTCCATTGCAAATGCAGG + Exonic
957083924 3:75663128-75663150 TGTGCTGCCTGTGCAAATAGTGG - Intergenic
957769900 3:84677056-84677078 TGAGATTCCTCTGTAAAGACTGG + Intergenic
961399129 3:126622540-126622562 TTTGATTTCTCTGCAAATGCAGG - Intronic
965181031 3:165404112-165404134 TGTAATTCCTGGGCAAATCCTGG + Intergenic
967955021 3:194871485-194871507 TGTGTTTGCTATGCAAACACAGG + Intergenic
968219525 3:196925992-196926014 TGTCAATTCTTTGGAAATACAGG - Intronic
968359433 3:198137008-198137030 TGTGGTTGCTTTGCAAATGAGGG - Intergenic
968402545 4:311134-311156 TGTGGTGCCTGTGCAAATGCTGG - Intergenic
968420670 4:481833-481855 TGTGGTGCCTGTGCAAATGCTGG + Intronic
968838905 4:2986173-2986195 TGTGATGCCTTTGCTAATACTGG + Intronic
970427818 4:15962221-15962243 GGTGATTCCTATGCAACTCCAGG + Intronic
970538247 4:17052121-17052143 AGTGACTCATTTGGAAATACAGG - Intergenic
971197388 4:24482584-24482606 TGTTATCCCTTTCCAAATAGTGG - Intergenic
975145386 4:70961877-70961899 TGTAATTACTTAGCTAATACAGG + Intronic
975676743 4:76834746-76834768 TGTGAGTCCTCTGCACACACAGG + Intergenic
977325772 4:95572848-95572870 TGCAATTCCTTGGCAACTACTGG - Intergenic
978837452 4:113169462-113169484 AGTCATTCCTTTGTAAAAACAGG - Intronic
979227708 4:118308315-118308337 TGTCATTCATTTGAAAATACTGG - Intronic
980033548 4:127857640-127857662 TGAGCTTACTTTGCAGATACAGG - Intergenic
981089364 4:140716571-140716593 TGTAATTACTTTGCAAAGAAGGG - Intronic
981234720 4:142401750-142401772 TCTGATTCCGTTCCATATACTGG - Intronic
982277680 4:153652893-153652915 TATTATTCCTTTGGAAACACGGG - Intergenic
982656729 4:158159282-158159304 TGTGGTTCCTTTCCACATACAGG + Intronic
982851440 4:160321182-160321204 TTTCTTTCCTTTGGAAATACTGG + Intergenic
985447067 4:190028460-190028482 TGTGCTGCCTGTGCAAATAGTGG + Intergenic
986125827 5:4881696-4881718 TGTGACTACTTTGAAAATGCAGG + Intergenic
986142881 5:5048406-5048428 TGTGATTCCCTTTCAAGCACTGG - Intergenic
988939198 5:36125172-36125194 TGTGATTCCTTAGGAACTACTGG - Intronic
989522916 5:42422478-42422500 TCTGATTCCTTTGAAAATAGGGG + Intergenic
989702294 5:44284146-44284168 TCTGATTCCTTTGTACATAAAGG + Intergenic
989988228 5:50728509-50728531 TGTGATTCCTATGAAAACAAGGG - Intronic
990432351 5:55748387-55748409 TTTCATTCCTTTACAAATATTGG - Intronic
991915675 5:71602747-71602769 TGTGTTTCCTTTATAATTACAGG - Intronic
992753261 5:79880545-79880567 CCAGATTCCTTTGCAACTACAGG + Intergenic
993156815 5:84235408-84235430 TGTGATTCCTGTGCAAAATTTGG + Intronic
993358419 5:86942881-86942903 TGTGATTCCTTAGAAATTATAGG + Intergenic
993507245 5:88724707-88724729 TATGAATCCTTTTGAAATACAGG - Intronic
994442061 5:99820275-99820297 TGTGTTTCCTTTGTGAATTCAGG - Intergenic
995476251 5:112551501-112551523 TGTGCTTCCTTGGTAAATTCTGG + Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
999919601 5:156304027-156304049 TGCAATTCCTGTGCAAGTACTGG - Intronic
1000513168 5:162208451-162208473 TCTAATTCCTTGGCAAATCCAGG + Intergenic
1000769211 5:165330789-165330811 TGTTATTCCTTTACCAAGACAGG - Intergenic
1000916480 5:167088230-167088252 TGTGATTTATTTCCAAATACAGG - Intergenic
1002393349 5:178933829-178933851 TGTGATTCCTTTGTACTTACAGG - Intergenic
1004612192 6:17253370-17253392 TTTGAATTCTTTGCAAATGCTGG - Intergenic
1006278525 6:33027443-33027465 TTTGAGTCCCATGCAAATACGGG - Intergenic
1006884206 6:37366934-37366956 TGATATTCCTTTGCATTTACAGG + Intronic
1007297582 6:40838064-40838086 TGTGGTTCATGTACAAATACTGG + Intergenic
1008251313 6:49243292-49243314 TGTGAATCATTTGAAAACACTGG + Intergenic
1010063114 6:71647089-71647111 TTTGAATCCTTTGTAAATTCTGG - Intergenic
1010367523 6:75068751-75068773 GGTGGTTTCTTTACAAATACTGG - Intergenic
1010471352 6:76231840-76231862 TGGGATTCCTTTGAAGAGACAGG + Intergenic
1010865356 6:80969914-80969936 TGTGGATCCTTTGGAGATACAGG + Intergenic
1011927689 6:92668170-92668192 TGTGAGTCTGTTGCAAATAGAGG - Intergenic
1012678231 6:102144107-102144129 TGTGATTCCATTTAAAACACAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013350555 6:109302022-109302044 AGTTTTTCCTTTGCAAATTCTGG - Intergenic
1013840429 6:114386005-114386027 TGTGATTCTTTTGACAATAGTGG + Intergenic
1015483397 6:133741222-133741244 TGTGATTTCTTTGCATTTTCTGG - Intergenic
1015854447 6:137608588-137608610 TGTGATCCCTTTGGACATACTGG - Intergenic
1017522981 6:155218549-155218571 CGTGATTCCTTTGACAACACTGG - Intronic
1017525659 6:155239684-155239706 TGTGATTCCTTTCCCATGACTGG + Intronic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1018036014 6:159882200-159882222 TATGGTACCTTTGCAAAGACAGG + Intergenic
1018965616 6:168486383-168486405 TGTGGGTCCTTTGCAAATGTTGG - Intronic
1019260565 7:79668-79690 TGTGGTTGCTTTGCAAATGAGGG + Intergenic
1024563734 7:50664820-50664842 TGTGACTCATTTGAAAAGACAGG - Intronic
1028820216 7:95200701-95200723 TCTGATTACTTTACAAAAACAGG - Intronic
1030079626 7:105766121-105766143 TGCGATTCCTTTGTAAATGAAGG - Intronic
1034027184 7:147718472-147718494 AGTGATTCTTATGCAAAAACTGG - Intronic
1034120923 7:148627091-148627113 TCCTATTCCTTTGCTAATACAGG - Intergenic
1034594620 7:152177934-152177956 TGTGCCTCCTCAGCAAATACAGG - Exonic
1037322662 8:17658637-17658659 TGTTATTCCTTTCCAAAGAGAGG - Intronic
1040427692 8:47305255-47305277 AGTGACTCCTATGCAAATACAGG + Intronic
1042239284 8:66646430-66646452 TGTGATTGCATTGAATATACAGG - Intronic
1042456881 8:69015502-69015524 TGTGAGTCCAGTGAAAATACGGG - Intergenic
1044235391 8:89824473-89824495 TGTGATTCCTGGGCAAGTCCTGG - Intergenic
1044336440 8:90989235-90989257 TGAGATTCATTGGCAAATAAAGG + Intergenic
1044438386 8:92193011-92193033 TGTGATTGCTTTTTAAATTCAGG + Intergenic
1045556713 8:103221480-103221502 TGTGTTTCTATTGCAATTACTGG - Intronic
1047038459 8:120965776-120965798 TGTGGTTACTTTGAAAATAGAGG + Intergenic
1051158583 9:14179774-14179796 TGTGATTTCTTTACAGATTCTGG - Exonic
1051368445 9:16337958-16337980 TGAGATTCCTTTGAAATAACAGG + Intergenic
1052974667 9:34401852-34401874 TGTGCTTGCTGTGCAAATGCAGG + Intronic
1058454395 9:105125744-105125766 TATCATACCTTTGCCAATACTGG - Intergenic
1060558623 9:124524077-124524099 TAAAATTCCTCTGCAAATACAGG + Intronic
1062744121 9:138200722-138200744 TGTGGTTGCTTTGCAAATGAGGG - Intergenic
1186101690 X:6164186-6164208 TGTGATACCTTTTCAGAAACTGG - Intronic
1187922095 X:24214583-24214605 TGTGACTCGGATGCAAATACTGG + Exonic
1188104351 X:26131481-26131503 TGCTATGCCTTTGAAAATACTGG + Intergenic
1188641899 X:32515722-32515744 AGTGATTCCTATGCACATAAAGG - Intronic
1188917275 X:35927263-35927285 TTTGATTCCTATGCAAAAATGGG - Intronic
1190144983 X:47882347-47882369 TTTGATTCCATTACAAAGACAGG - Intronic
1192349241 X:70342403-70342425 TGTGATTGATTTCCAAATAGTGG + Intronic
1194287262 X:92025246-92025268 TGTGAGTCCCTTGCAGATTCTGG - Intronic
1196838248 X:119833231-119833253 TTTGATTTCTTTGGAAATAAAGG - Intergenic
1198012129 X:132568215-132568237 TGTGACTCATTTACAAATTCTGG - Intergenic
1199185548 X:144911185-144911207 TGTTATTCCTTAGCAGAGACTGG - Intergenic
1199514247 X:148657685-148657707 TGTGATTGCTTAGAAAATAATGG + Intronic
1200604799 Y:5249815-5249837 TGTGAGTCCCTTGCAGATTCTGG - Intronic