ID: 911211640

View in Genome Browser
Species Human (GRCh38)
Location 1:95145593-95145615
Sequence TTCTAACATATGAAGATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911211639_911211640 -3 Left 911211639 1:95145573-95145595 CCATTACTTTAAAAAATCTTTTC 0: 1
1: 1
2: 19
3: 136
4: 1225
Right 911211640 1:95145593-95145615 TTCTAACATATGAAGATAGATGG 0: 1
1: 0
2: 0
3: 28
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911211640 Original CRISPR TTCTAACATATGAAGATAGA TGG Intronic
901988820 1:13096003-13096025 TGCTAAAAGATGAAGATAAAAGG - Intergenic
901992993 1:13130764-13130786 TGCTAAAAGATGAAGATAAAAGG + Intergenic
902475549 1:16682927-16682949 TTTTAACATATGAAGAAACTGGG + Intergenic
905679747 1:39860744-39860766 TCCCAACATATAAAGAAAGAAGG - Intronic
907088758 1:51704670-51704692 TTCCAACACATGAGGATATAAGG - Intronic
907594756 1:55709188-55709210 TTATAAGATAAGAAAATAGATGG + Intergenic
907877183 1:58502674-58502696 TTCTGACATATAATGAAAGAAGG - Intronic
908265368 1:62373535-62373557 TTCTAACATATGAATTTTGGCGG + Intergenic
909832392 1:80209148-80209170 TTTTAACATCTGAATTTAGAGGG - Intergenic
909904027 1:81174677-81174699 TTCTACCACATGAATTTAGAGGG + Intergenic
910066591 1:83160347-83160369 TCATAATATATGAAGTTAGAAGG - Intergenic
911211640 1:95145593-95145615 TTCTAACATATGAAGATAGATGG + Intronic
911386161 1:97178057-97178079 TTTTAACATATGAATTTTGAAGG + Intronic
911687304 1:100792166-100792188 TTTTAACATATGAATTTTGAGGG + Intergenic
912254816 1:108047906-108047928 TTTTAACATATGAAGACTCAAGG + Intergenic
912688939 1:111789203-111789225 TTCATCCATATGAAGAAAGAGGG + Intronic
913065838 1:115253928-115253950 TTCCAACATATGAATTTTGAGGG - Intergenic
913138268 1:115913726-115913748 TTCTAAAATAAGATAATAGATGG - Intergenic
913412402 1:118566820-118566842 TTTTAAGAGATGAAGATAGAAGG + Intergenic
913419305 1:118647480-118647502 TTGTAACATAAGCACATAGAAGG - Intergenic
914202374 1:145497333-145497355 TGATAAAATAAGAAGATAGAGGG + Intergenic
914481498 1:148070483-148070505 TGATAAAATAAGAAGATAGAGGG + Intergenic
915644910 1:157263256-157263278 TTCTAACACATGAACTTTGAGGG + Intergenic
916115744 1:161483775-161483797 TTCTAATATATAAAGATTGAAGG + Intergenic
916359779 1:163955238-163955260 TAATGACATATGTAGATAGAAGG - Intergenic
916930007 1:169567136-169567158 TTCTACCATGTGAGGATACAAGG - Intronic
917035291 1:170741964-170741986 TTCCAACATATGAATTTAGATGG + Intergenic
917128111 1:171709592-171709614 TTCAAACACATGAAGAAAAAAGG - Intronic
917636857 1:176945420-176945442 ATCTAACAATTGAAGATAGCTGG + Intronic
919144396 1:193615337-193615359 TTCTATCATATAAAGACACAGGG - Intergenic
919331541 1:196178321-196178343 CTCTACCATATGAAGATACAGGG + Intergenic
919432567 1:197514682-197514704 TTCAAACATATGCAGAAGGAAGG - Intronic
919489746 1:198192069-198192091 TTCTAAAATATGAAAAAAGGAGG - Intronic
919509347 1:198441721-198441743 TTCTTAAATATAAAGAAAGAAGG - Intergenic
922384600 1:225069791-225069813 TTCTACCAGATGAACAAAGAAGG - Intronic
1063256066 10:4328821-4328843 TTCTATCATAGGAAGTTAAAAGG + Intergenic
1063634685 10:7770427-7770449 TTTTAACAAATGGAGATAAAAGG - Intronic
1065052671 10:21811805-21811827 TTCTCACATATAAATACAGAGGG + Intronic
1067390615 10:45859772-45859794 TTTTAACACATGAACATTGACGG - Intergenic
1067500856 10:46804062-46804084 TTTTAACACATGAACATTGACGG + Intergenic
1067872663 10:49976300-49976322 TTTTAACACATGAACATTGATGG + Intergenic
1068149854 10:53118040-53118062 TACTAATATATGAATAGAGAGGG - Intergenic
1068615644 10:59112626-59112648 TTCCAACATAAAAAGATGGAAGG - Intergenic
1068627772 10:59267943-59267965 TTCTTACATAAGAAGAAAGGAGG + Intronic
1068720737 10:60243264-60243286 TTCTAACATATAAAATTAGGGGG - Intronic
1068860429 10:61842287-61842309 TTCAAAGATATGTAGATAGTTGG - Intergenic
1070137803 10:73710013-73710035 TTTTAACACATGAACATTGACGG - Intergenic
1070519533 10:77239922-77239944 TTCTAGCATATGTAGGTATAAGG - Intronic
1070649296 10:78223147-78223169 TTCTTACTTATGCAGAGAGAAGG + Intergenic
1071219616 10:83449404-83449426 TAGTAACAGATGAAGAGAGATGG + Intergenic
1071745078 10:88408350-88408372 TTCTAACATATGAATTTTGGAGG - Intronic
1072107204 10:92285582-92285604 TTCTAACATATGAACATTGGGGG + Intronic
1072780834 10:98250506-98250528 TTTTAACCCTTGAAGATAGAGGG + Intronic
1072897610 10:99380238-99380260 TTTCAACATATGAATATTGAGGG + Intronic
1073255562 10:102148806-102148828 TCCAAACATAGGAAGAAAGAAGG + Exonic
1073524169 10:104163814-104163836 AACTAAGAGATGAAGATAGAAGG + Intronic
1073820504 10:107257695-107257717 TTCTAAAATATAGAGAAAGAGGG + Intergenic
1074730696 10:116371573-116371595 ATCTAAATTATGAAGATATAAGG - Intronic
1079310182 11:19358414-19358436 CTCTAACATATGCAGTTACATGG - Intronic
1079814014 11:25032436-25032458 TACTAAAATATGAAGAAATAAGG - Intronic
1079863738 11:25708337-25708359 TCTGAACACATGAAGATAGATGG - Intergenic
1080344327 11:31307137-31307159 TTCAAACATTTGAAAATAGTGGG + Intronic
1080692378 11:34569247-34569269 TTATAAAATCTGGAGATAGATGG - Intergenic
1081009169 11:37786312-37786334 TTCTCACAAATTAACATAGATGG - Intergenic
1081118041 11:39229504-39229526 TTCTAACATATGAATTTTGGGGG + Intergenic
1082885448 11:58077432-58077454 TTCTAGCATAGGAATAAAGATGG + Intronic
1084404872 11:68965859-68965881 TTTTAACATATGAATTTTGAAGG + Intergenic
1085872090 11:80362495-80362517 TTTTAACATATGAATTTAGGGGG + Intergenic
1086797802 11:91130351-91130373 TTCTAATTTTTGAAGAGAGATGG + Intergenic
1086937524 11:92761398-92761420 TTTTAACATATGAATTTTGAAGG + Intronic
1087353553 11:97064114-97064136 TTCTAACAAATGTACAAAGAAGG + Intergenic
1087593908 11:100229308-100229330 ATCTATCTTATGATGATAGAAGG - Intronic
1087881842 11:103425405-103425427 TTCCACCATATGAGGATACAAGG - Intronic
1087893405 11:103560838-103560860 TTCTATCATAGGAAGAGAGATGG - Intergenic
1088041723 11:105393150-105393172 TTCTAAAAAATCAAGACAGATGG + Intergenic
1088262930 11:107961292-107961314 TTCTACCATGTGAGGATACAAGG - Intronic
1093017855 12:14172390-14172412 TTCTTACAGATAAAGAAAGATGG + Intergenic
1093187138 12:16033437-16033459 TTGAAACATATGAAGTTAAAAGG + Intronic
1093242754 12:16697999-16698021 TTCAAACACATGAACATAGGGGG - Intergenic
1095124743 12:38463352-38463374 TCCAAGCATATGAAGAGAGATGG - Intergenic
1095270613 12:40214443-40214465 TTCCAACATATGAATTTAGGGGG - Intronic
1095436035 12:42188847-42188869 GACTAAAAGATGAAGATAGATGG + Intronic
1095533773 12:43222276-43222298 TTCTACCATATGATGGCAGAAGG + Intergenic
1095545970 12:43370764-43370786 TTCTAAAATAACAAGACAGATGG - Intronic
1098887217 12:75972539-75972561 TTCTAACTAATAAAGGTAGAAGG - Intergenic
1099109303 12:78537521-78537543 TTCTACCATGTGAGGATAAAAGG - Intergenic
1099277781 12:80600068-80600090 TTTTAAAAAATGAAGAAAGAAGG + Intronic
1100123758 12:91398402-91398424 TTCCAACATATGAATTTTGAAGG + Intergenic
1100288062 12:93186674-93186696 TTCCAACATATGAATTTTGAAGG - Intergenic
1100522816 12:95391828-95391850 GTCTAACATAGGAAAATAAAAGG + Intergenic
1100693651 12:97066392-97066414 TTCTATCATGTGAGGATACAAGG + Intergenic
1101311177 12:103580892-103580914 TTCTAGGATTTGGAGATAGAAGG - Intergenic
1101702111 12:107183704-107183726 TTCTAGCATAAGGAGAAAGAGGG + Intergenic
1101799450 12:108008023-108008045 TTCAAACCTATAAACATAGAGGG + Intergenic
1106461720 13:29976371-29976393 TTCTCACATCCTAAGATAGAAGG - Intergenic
1106933504 13:34692697-34692719 TTCCAACATATGAATTTGGAGGG + Intergenic
1107161127 13:37229336-37229358 TTTTAACATATGAATTTTGAAGG + Intergenic
1107668526 13:42718096-42718118 TTCTAAGATTTGTAGGTAGATGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108274107 13:48790583-48790605 TTCTAACATGAAAAGATAAAGGG + Intergenic
1108964524 13:56281029-56281051 TTTTAACATATGAAAGTATAAGG + Intergenic
1109637891 13:65147329-65147351 TACTAAGATATGCAGAAAGATGG - Intergenic
1110702331 13:78563203-78563225 TTATAAGTTGTGAAGATAGAAGG + Intergenic
1110985344 13:81959957-81959979 TTGAAACAAATGAAAATAGAGGG + Intergenic
1111953011 13:94725232-94725254 TTCCAACATATGACTTTAGAGGG - Intergenic
1112808987 13:103195527-103195549 TTATAAGATATGAATCTAGAAGG + Intergenic
1113053296 13:106238218-106238240 TGATAACATGTTAAGATAGATGG - Intergenic
1114838587 14:26234367-26234389 TTGCAATATATGAAAATAGAGGG + Intergenic
1114843359 14:26291624-26291646 TTTTAACATATGAATTTTGATGG + Intergenic
1114936591 14:27546803-27546825 TTCTCATATGTGAAGATAGAGGG + Intergenic
1115283560 14:31691923-31691945 TTCTAGCAGATGAGGTTAGAAGG - Intronic
1116182483 14:41552683-41552705 TTCTCAAATATGAAAATATAAGG - Intergenic
1117111735 14:52464248-52464270 TTATTACATATGACGATAGACGG + Intronic
1117375455 14:55114835-55114857 TTTCAACACAGGAAGATAGAGGG - Intergenic
1118628327 14:67679318-67679340 TTCCAACATATGAACCTTGAGGG + Intronic
1120363023 14:83530185-83530207 CTGTATCATAGGAAGATAGAGGG - Intergenic
1120374351 14:83681893-83681915 TTGTAACAGAAGAAGATAGATGG + Intergenic
1121927316 14:97939627-97939649 TTCTAACACAGGATGATACATGG - Intronic
1121973550 14:98381651-98381673 TTCTAACATAAGAAAAAAAATGG - Intergenic
1125990164 15:44098770-44098792 TTCTAATATATGAAGTTTAAAGG - Intronic
1126434330 15:48620485-48620507 TATTAACATATGAATTTAGATGG - Intronic
1126956049 15:53934946-53934968 TTTCAACATATGAAGTTAGGGGG + Intergenic
1128907753 15:71483289-71483311 TTCACACGTATGAAGATTGAGGG - Intronic
1129018591 15:72492465-72492487 TTCTCACATTTGAAGTTAAACGG - Intronic
1129655187 15:77519430-77519452 TTCTAACATGTGAATATTGGAGG - Intergenic
1130747137 15:86667047-86667069 ACCTAACATATCAAGATAAAGGG - Intronic
1130754923 15:86753094-86753116 TTTTAACAGATTTAGATAGAAGG - Intronic
1131347627 15:91665393-91665415 TTCTAGCACGTGAATATAGATGG + Intergenic
1131533204 15:93212265-93212287 TTCTACCATGTGAAGACACAGGG + Intergenic
1133597451 16:7306440-7306462 TGGTTCCATATGAAGATAGATGG + Intronic
1134535251 16:15021045-15021067 TCCTAACATATGATGAACGAAGG - Intronic
1134755239 16:16661128-16661150 TTTTGACATATGGAAATAGATGG - Intergenic
1134990827 16:18698043-18698065 TTTTGACATATGGAAATAGATGG + Intergenic
1137234155 16:46599777-46599799 TTCTAAGATTTGAAGGTAAACGG - Intronic
1137754141 16:50888048-50888070 TTTTAACATATGCAGATTTATGG + Intergenic
1138879690 16:60996259-60996281 TTCTAACATATATAAATACAAGG + Intergenic
1139246698 16:65451824-65451846 TTTGAACAAATGAAGACAGAAGG + Intergenic
1139860799 16:70019740-70019762 TCCTAACATATGATGAACGAAGG + Intergenic
1140957675 16:79880687-79880709 TTCTAAGATAAGGGGATAGATGG + Intergenic
1141021227 16:80498251-80498273 TTCCAACATATGAATTTGGAGGG + Intergenic
1144380277 17:14688177-14688199 ATCTAAGATATTAAGAAAGAGGG + Intergenic
1144597400 17:16582658-16582680 TTTCAACATATGAACTTAGAGGG - Intergenic
1145218951 17:21072952-21072974 TTCTAACATATGTAGAGACTTGG - Intergenic
1146088251 17:29850644-29850666 TTCTAAAAGAGGAAGAGAGAGGG - Intronic
1146487428 17:33254715-33254737 TTTTAAAATATGAAGTTTGAAGG - Intronic
1148826174 17:50396063-50396085 TTCTACCCCAGGAAGATAGATGG - Intronic
1149167774 17:53774243-53774265 TTCCAAACTATGAACATAGAAGG + Intergenic
1149613321 17:57974899-57974921 TTCTAAAATAAGAAGAAAAAGGG + Exonic
1152384921 17:79966894-79966916 GTTCAACATATGAAAATAGATGG + Intronic
1153279445 18:3400584-3400606 TTCCAACATGTGAAGTTTGAGGG - Intergenic
1155400750 18:25436527-25436549 TTATTACAGATGAAGATAGAAGG + Intergenic
1156812559 18:41270406-41270428 TACTAAAATATGAAGAAATAAGG - Intergenic
1157044156 18:44077384-44077406 TTCAAATATATGAAAATATAAGG - Intergenic
1157155745 18:45264060-45264082 TTCTAATAGATAGAGATAGATGG - Intronic
1159358208 18:67364426-67364448 TTCTCCCATGTGAGGATAGAAGG - Intergenic
1162231729 19:9272166-9272188 TTTTAAAATATAAAAATAGAAGG - Intergenic
1164102141 19:22065788-22065810 TTCTACTATATGAACAGAGAGGG + Intronic
1202709784 1_KI270714v1_random:11981-12003 TTTTAACATATGAAGAAACTGGG + Intergenic
925858406 2:8152472-8152494 ATCTAAAATAAGAAGATACATGG + Intergenic
926110325 2:10178733-10178755 TTCCAACATATGAATTTAGGAGG - Intronic
926882890 2:17568070-17568092 ATATAATATAAGAAGATAGATGG - Intronic
927442225 2:23127337-23127359 TTTCAACATATGAATTTAGATGG + Intergenic
928494219 2:31815237-31815259 TACTAAAAGATGAAGATGGATGG - Intergenic
929407042 2:41654304-41654326 TTCTAACATATGTAAAAAAAAGG + Intergenic
929698390 2:44140123-44140145 TTCCAACATATGAATATTGAGGG + Intergenic
930943451 2:57041726-57041748 TTGGAACATTTTAAGATAGATGG + Intergenic
932142044 2:69287719-69287741 TTGTAATATATCAACATAGATGG + Intergenic
933238391 2:79891030-79891052 TTCCAACATATGAATTTTGAGGG + Intronic
933281406 2:80336352-80336374 TTTTAACATATGAATTTAGGGGG + Intronic
933687393 2:85153808-85153830 TTCACACATATGCAGAAAGAAGG - Intronic
934945846 2:98540849-98540871 TTCTAACATATGAACTTTGGGGG + Intronic
935357943 2:102221873-102221895 TTATAACATATGCACATATATGG + Intronic
935814227 2:106831372-106831394 TTCTAACAGAGGAAGAAATAAGG + Intronic
935927435 2:108085305-108085327 TTATAACATATGTAGATGTATGG - Intergenic
936347527 2:111686683-111686705 TTCCAACATATGAATTTTGAAGG - Intergenic
936806552 2:116339421-116339443 TTTTAAAAGATGAAGATAAAGGG + Intergenic
937717905 2:125055884-125055906 TTCTAACATCAGAAGATATAAGG - Intergenic
939235457 2:139486306-139486328 TTCTAGCATATGGAGGTAGAGGG - Intergenic
940251590 2:151683126-151683148 TTCTATCAAATTAAAATAGAAGG + Intronic
940325998 2:152425617-152425639 TTCTGGCATATTAAGATATATGG - Intronic
940434828 2:153639163-153639185 TTTTAATAGATGAAGAGAGAAGG + Intergenic
941739018 2:169013083-169013105 TTAAAACATAGTAAGATAGAAGG + Intronic
942482364 2:176403032-176403054 TTCTAACATATAAAAATGGAAGG - Intergenic
943004032 2:182367403-182367425 TTGAAACATATGAAGATAAAAGG - Intronic
943158358 2:184214193-184214215 TTCCAAAAGATGAAGAAAGAAGG - Intergenic
943222689 2:185131592-185131614 TTCTAAAATATGAAGTTACTCGG + Intergenic
943428545 2:187768196-187768218 GTGTAACATATGATGATATAAGG + Intergenic
943803625 2:192093451-192093473 TTCTAATATGTGATGAGAGATGG - Intronic
944127068 2:196306128-196306150 TTAGACCATATGAAGATGGAGGG + Intronic
944190294 2:196996003-196996025 CTGTACCTTATGAAGATAGATGG + Intronic
944508408 2:200439601-200439623 TTATAAGATATTAGGATAGAAGG - Intronic
945524787 2:210874603-210874625 TTCTAACATAAGAGTATTGAGGG + Intergenic
945930756 2:215852692-215852714 TTTTAACATATGAATTTGGAGGG + Intergenic
946519238 2:220447513-220447535 TTCTAACACATGAACTTTGAGGG - Intergenic
947801701 2:232932754-232932776 TTCTAACGCATGAGGATACAAGG - Intronic
1172456392 20:35077642-35077664 TACTAACGTAAGAAGATTGAAGG - Intronic
1174917724 20:54670672-54670694 TACAAACATAGTAAGATAGATGG + Intergenic
1175266138 20:57704620-57704642 TGCTAACACCTGAAGAGAGAAGG + Intronic
1176964775 21:15199822-15199844 TTCTAATCTGTGAAAATAGAGGG - Intergenic
1177220488 21:18185972-18185994 TTTTAACATATGAATTTTGAGGG + Intronic
1177748329 21:25249382-25249404 TTCTAAAATATGAAAAAAGGAGG + Intergenic
1178193424 21:30314274-30314296 TAATAACATATAAAGACAGATGG - Intergenic
1179089417 21:38250757-38250779 TGCTAAAATATGAAAATGGAAGG + Intronic
1182835912 22:33341212-33341234 TTCCACCATGTGAAGACAGATGG + Intronic
1183017868 22:35004671-35004693 TTTTAACATATGAACCTGGATGG + Intergenic
1184304102 22:43583559-43583581 TTTTAACATATGAATTTTGAGGG - Intronic
1184878546 22:47290734-47290756 TTCTGACGTGTGAAGAGAGATGG + Intergenic
949251391 3:1988143-1988165 TTTTAAGATTTGTAGATAGAAGG + Intergenic
950944612 3:16931984-16932006 TTCTGCCATGTGAAGATATAAGG + Intronic
951282708 3:20772261-20772283 TTCTAAAATCTGAAAAAAGAAGG - Intergenic
953499139 3:43416075-43416097 TTCTCACATATGAAAGTAGAGGG + Intronic
954234984 3:49249647-49249669 TTCTACCATATTCATATAGATGG - Intronic
955302961 3:57800788-57800810 TTCTCACAGATGAAAATAGGAGG + Intronic
955778274 3:62456885-62456907 TTCGAACATAGGAAGAGAAATGG + Intronic
956505041 3:69929053-69929075 TTCTAACTTAGGAAGACTGAGGG + Intronic
956701980 3:71966631-71966653 TCCTAAGATATGAAGACAAATGG - Intergenic
957461793 3:80531514-80531536 TTCTAATATAAGAACATAGTAGG - Intergenic
958812049 3:98871809-98871831 TTCTAAAAGATGGAGAAAGAGGG - Intronic
959399796 3:105886036-105886058 ATCCAACATAAGAAAATAGAAGG - Intergenic
959430031 3:106242130-106242152 ATCAAAGATATGAAGATAAAAGG - Intergenic
960593484 3:119387560-119387582 TTTTAACATATGAATTTTGAGGG + Intronic
960777276 3:121271125-121271147 ATCTAACTTATAAATATAGAAGG - Intronic
961020258 3:123499366-123499388 TTTTTACATTTGAAGAGAGATGG + Intronic
962313248 3:134340715-134340737 ATCTCACATATGAGGAAAGACGG + Intergenic
965011016 3:163091055-163091077 TCCCACCATGTGAAGATAGAAGG + Intergenic
965152475 3:164996700-164996722 TTATAATTTATGAAGATAAAAGG + Intronic
965238360 3:166158026-166158048 TTCTACCACATGAAGATACAAGG + Intergenic
966480110 3:180398212-180398234 CTCTAAGACATGAAGATAAAAGG + Intergenic
967604775 3:191432451-191432473 TTTTAACATATGAATTTTGAGGG + Intergenic
969172388 4:5374753-5374775 TTTCAACATATGAATATTGACGG + Intronic
970075194 4:12210566-12210588 TTCTGCCATGTGAAGATATAAGG + Intergenic
971789855 4:31155510-31155532 TTTTAACATATGAATTTGGAGGG + Intergenic
971809614 4:31407662-31407684 TTCTAACACAGTAAAATAGAGGG - Intergenic
971849469 4:31965065-31965087 TTATAACCTAAAAAGATAGAAGG + Intergenic
972107933 4:35515182-35515204 GTCTAGCATATGAAGAAAGTAGG + Intergenic
972708985 4:41574583-41574605 TCCTAAAATATGAAAAGAGATGG - Intronic
973057371 4:45678265-45678287 ATCCAACATATCAAGATAGCTGG - Intergenic
974213569 4:58815367-58815389 ATCTAACTTAGTAAGATAGAGGG - Intergenic
974677389 4:65111279-65111301 TTTTAACATATGAATTTTGAAGG - Intergenic
975256184 4:72237585-72237607 TTCTTACATATTATGATTGAAGG + Intergenic
975555242 4:75656891-75656913 TTTGAAGATATGAAGATAGAAGG - Intronic
976989225 4:91344051-91344073 TTTCAACATATGAATATTGAGGG - Intronic
977101948 4:92827448-92827470 TTTTAACAAATAAAGACAGAAGG - Intronic
977560364 4:98526726-98526748 TTCTAAGAAATGGAGATGGAAGG + Intronic
978526985 4:109677496-109677518 TTCTAACACATGAATTTTGAGGG - Intronic
978576238 4:110193041-110193063 TTCTTACAAATGAATGTAGAAGG + Intronic
978907322 4:114022255-114022277 TTTCAACATATGAAGTTGGAGGG - Intergenic
978976144 4:114876331-114876353 TCATAAAATGTGAAGATAGATGG + Intronic
979169273 4:117579628-117579650 TTCTAACATACGTAGAGAAAGGG + Intergenic
979792638 4:124805006-124805028 TTTTAACATATGAATTTTGAAGG + Intergenic
980157019 4:129119576-129119598 TTCTCATATATAAAGATAAAAGG - Intergenic
980344789 4:131600089-131600111 TTCAAACATATGAAGATAATAGG + Intergenic
980699791 4:136410394-136410416 TTCTAACATATGCAGATCATAGG - Intergenic
980763994 4:137274708-137274730 TTCAAAGATATGAAGATCAAAGG - Intergenic
981243277 4:142504438-142504460 TTCTAACAGATGTTGCTAGATGG - Intronic
981819960 4:148874924-148874946 TTCAAACATTTGACAATAGAGGG + Intergenic
982587913 4:157266052-157266074 CTCTAACTTATCAAGACAGAAGG - Intronic
982728014 4:158926057-158926079 CTTTAACATATGAATATTGAGGG + Intronic
984267606 4:177513263-177513285 TTCTACCACATGAGGATACATGG - Intergenic
984509194 4:180658075-180658097 TTCTAACAAATGATGAATGACGG + Intergenic
985260192 4:188107688-188107710 TTTTAGCATATGAAAATAAAAGG - Intronic
985918365 5:2945894-2945916 TTTAAATATATGAAGATAGCAGG - Intergenic
986312630 5:6565153-6565175 ATCTCACTTATGAAGATGGATGG - Intergenic
986513825 5:8540126-8540148 TTATAACAGATGAATAAAGATGG - Intergenic
987273880 5:16341763-16341785 TTTTAACATATGAATTTTGAAGG - Intergenic
987294885 5:16541125-16541147 TTCTAACATATGAATTTTGGAGG - Intronic
987771769 5:22314593-22314615 TTCTAAAATGTGAATATACATGG + Intronic
987808901 5:22807271-22807293 TTCAAGGATATGATGATAGATGG + Intronic
988231599 5:28486991-28487013 TTTTAACATATGAAGTCAGTCGG - Intergenic
989269661 5:39517314-39517336 TTTTAACAGATGAAGAAAAAGGG + Intergenic
990358463 5:54994903-54994925 TTCTACCATGTGAGGATACAAGG - Intronic
990413237 5:55561872-55561894 ATTTAATATATGAAAATAGATGG + Intergenic
991943271 5:71875756-71875778 TTTTAACATATGAATATTGGGGG - Intergenic
992279909 5:75163684-75163706 TTCTTACATAAGAAGTTAGTAGG - Intronic
992341458 5:75828011-75828033 TTTTAAAATATGAAGATGGAGGG - Intergenic
992773881 5:80073067-80073089 TTCTAAAATATCAAGCTACATGG - Intronic
992863014 5:80930889-80930911 TTCTAACATATGAATTTTAAAGG + Intergenic
992973030 5:82082228-82082250 ATCTGTCATATGAAGATAAAAGG + Intronic
994015766 5:94963142-94963164 TTCCAACATATGAATTTTGATGG + Intronic
994052270 5:95375772-95375794 TTCTAACAGATGCAGAGAGCTGG + Intergenic
994818875 5:104622421-104622443 TTCTCACAAATGAAGACAGATGG + Intergenic
995058565 5:107789176-107789198 TTTCAACATATGAATTTAGAGGG - Intergenic
995072464 5:107940563-107940585 TGCTAACACATGGAGATGGAAGG + Intronic
995103307 5:108343046-108343068 TTCTACCATGTGAGGATACAGGG + Intronic
995956505 5:117783128-117783150 TTGTAAAAACTGAAGATAGAAGG + Intergenic
996194834 5:120591392-120591414 TTTTGACAAATGAAGAAAGAGGG - Intronic
996728895 5:126698048-126698070 TTCTAACATATGAATTTTGGAGG + Intergenic
996973228 5:129397958-129397980 TTCTAACAAATGAAAATATGTGG + Intergenic
997082836 5:130761025-130761047 TTATAACTTATGAAAATAGTTGG + Intergenic
999007537 5:147999057-147999079 TTCTAAGATAATAAGAGAGAAGG + Intergenic
999430857 5:151524342-151524364 TTTTAACATATGAATTTTGAGGG - Intronic
999610971 5:153369170-153369192 CTCTAACATATTAAGATATGAGG - Intergenic
1000375226 5:160574577-160574599 TTCCAACATATGAGTTTAGAGGG - Intronic
1002023459 5:176381074-176381096 TTCTTACATATAAAATTAGATGG + Exonic
1003420163 6:5950455-5950477 TTCTCACCTATGAGGATATATGG + Intergenic
1004255667 6:14061550-14061572 TTTTAACATATGAATTTTGAGGG - Intergenic
1005176497 6:23051837-23051859 TTCTAAAATATGAAAAAAAAAGG - Intergenic
1007364350 6:41380610-41380632 TTTCAACATATGAATTTAGAGGG + Intergenic
1007533048 6:42560163-42560185 TTCTTAAATATGAAGACAGGCGG - Intergenic
1008099405 6:47375110-47375132 TTCCAACACATGAATATAGACGG + Intergenic
1009466653 6:63978858-63978880 TTTTAACATTTGTAGAAAGAAGG - Intronic
1009701552 6:67189622-67189644 TTATAACATATGTACATATATGG - Intergenic
1011560946 6:88614783-88614805 TTTTAACATAGGAATTTAGATGG - Intronic
1012828821 6:104180956-104180978 TTCCAACAGATGAATATTGAGGG + Intergenic
1012837632 6:104290363-104290385 TTTAAACATATGGAGATATATGG - Intergenic
1013427208 6:110023573-110023595 TTCTGATAGATGATGATAGAAGG + Intergenic
1015153981 6:130069960-130069982 TTCTAACATTTTCAGATACACGG + Intronic
1015582116 6:134736879-134736901 TTCTGCCATGTGAAGATACAAGG - Intergenic
1016176864 6:141088914-141088936 TTGTATCATATGAAGTTTGAGGG - Intergenic
1016692109 6:146950046-146950068 TTCTAACATAGGAGGAGGGAGGG + Intergenic
1017059811 6:150471638-150471660 TTCTAACATTTTAAGAGCGAAGG + Intergenic
1018296093 6:162345843-162345865 TTCCAACATATGAAATTTGAGGG - Intronic
1019085525 6:169472039-169472061 TTCTAACACATGAAATTTGAGGG + Intronic
1020067960 7:5204152-5204174 TTCAAACATATAAATATACATGG - Intronic
1020922850 7:14286328-14286350 TGCTAACATGTGAAGCTATATGG - Intronic
1021263313 7:18486218-18486240 TTCCAACATATGAACTTTGATGG + Intronic
1022149430 7:27585961-27585983 TTCTAATCTAAGAAGATAGGTGG + Intronic
1022236962 7:28471242-28471264 TTTTTACATATGATGAGAGATGG + Intronic
1022843074 7:34182958-34182980 TTCTACCATATGAGGACACATGG + Intergenic
1023111424 7:36815205-36815227 TTCTAACATGTGAGGATACGGGG + Intergenic
1023242716 7:38165184-38165206 TTCTAAAATATTAAAAAAGAGGG + Intergenic
1023319827 7:38982812-38982834 CTCTAACATATGCAGAGAGGTGG + Intronic
1023692815 7:42809321-42809343 TTCAAACATATAGAGAAAGAGGG + Intergenic
1024781295 7:52853374-52853396 TTAAATCATTTGAAGATAGAAGG - Intergenic
1024893922 7:54234624-54234646 TTCCAACAGATTAAGAAAGAGGG + Intergenic
1025338013 7:58433951-58433973 TTTTATCATATAATGATAGACGG + Intergenic
1025349335 7:58634596-58634618 TTTTATCATATAATGATAGACGG + Intergenic
1025453119 7:60476260-60476282 TTTTATCATATAATGATAGACGG + Intergenic
1025470440 7:60785283-60785305 TTTTATCATATAATGATAGACGG + Intergenic
1025567703 7:62507775-62507797 TTTTAACATATAATGCTAGACGG + Intergenic
1026071241 7:67122252-67122274 TCCTAACATCTGTAGAGAGAGGG - Intronic
1026705649 7:72690034-72690056 TCCTAACATCTGTAGAGAGAGGG + Intronic
1027277519 7:76574413-76574435 TCATAATATATGAAGTTAGAAGG + Intergenic
1027565811 7:79792136-79792158 TTCTCACCTATGAACATAAAAGG - Intergenic
1029352151 7:100021434-100021456 TTCTAAAATGTGAACATAGATGG + Intronic
1030369898 7:108687024-108687046 ATTTGACATATGAAGATAGGTGG + Intergenic
1030822976 7:114118042-114118064 TTCTAACATATGAATGTTGAGGG + Intronic
1031611159 7:123829095-123829117 TTCAGGCATATGCAGATAGAAGG - Intronic
1031639298 7:124141964-124141986 TTCTAACATAAGAAATGAGATGG - Intergenic
1032748498 7:134812272-134812294 TTCTACCACATGAAGCTAGGTGG - Intronic
1033756693 7:144402455-144402477 TTCTAACAGATGAAGAAATGAGG + Intronic
1033764209 7:144470272-144470294 TTCTAAAATGCAAAGATAGAAGG + Intronic
1037074554 8:14697905-14697927 TTCTAACATATAGAGAGGGAGGG - Intronic
1037199361 8:16232789-16232811 TTTTAACATATGAATTTTGAGGG + Intronic
1037224375 8:16567342-16567364 TGCTAACATATGTAGTTATATGG + Intronic
1037605512 8:20434601-20434623 TTCTTCCAAATGAAGCTAGAAGG + Intergenic
1041905014 8:63023056-63023078 TTTCAACATATGAAGTTTGAAGG - Intronic
1041977019 8:63811075-63811097 TTCTGACACCTGAAGACAGAAGG + Intergenic
1042473166 8:69214168-69214190 TTCTACTATATGAAGACACAGGG + Intergenic
1042728736 8:71907631-71907653 ATTTAACTTATGAAAATAGATGG - Intronic
1044364456 8:91326605-91326627 TTTGAACATATGAATATTGAAGG + Intronic
1044567720 8:93683144-93683166 TTCTAACAAATGAACTTTGAGGG - Intergenic
1044748666 8:95395483-95395505 ATATAAGATAAGAAGATAGAAGG + Intergenic
1044801153 8:95957825-95957847 TTTTAACATATGAATTTTGAAGG - Intergenic
1045694966 8:104798694-104798716 TTATAAAATATAAAGTTAGAGGG - Intronic
1045746639 8:105430531-105430553 TGCTAAAAAATGAAGAGAGAGGG + Intronic
1046688392 8:117253808-117253830 TTCTACCAGATGTACATAGAAGG + Intergenic
1047291284 8:123532497-123532519 TTTTAACCTATGAACACAGAGGG + Intronic
1047636946 8:126774083-126774105 TTTTAACATATGAATTTTGAAGG + Intergenic
1049111101 8:140643991-140644013 TTCTACCATATGAGGATACAGGG + Intergenic
1050093681 9:2041571-2041593 TTTTAACATATGAATTTTGAGGG + Intronic
1050259738 9:3828723-3828745 TTCTCACAGATGAAGAAATAGGG + Intronic
1051001161 9:12284218-12284240 ATCTAATATATGAAAATGGATGG - Intergenic
1051124534 9:13789302-13789324 TACCATCATATGAAGAGAGAAGG - Intergenic
1051171233 9:14319637-14319659 TTGTAACATAGGAAAACAGATGG + Intronic
1052220468 9:26016077-26016099 TTCTATTATATGAAAAAAGAGGG - Intergenic
1052872434 9:33520901-33520923 TTCTAATACATAAATATAGAAGG + Intergenic
1052919072 9:33948791-33948813 TTCTGACATAAGAAGTTAAAGGG + Intronic
1055246672 9:74253545-74253567 TACAAAGATATGAAGATAAACGG - Intergenic
1055251325 9:74310066-74310088 CTCTAACATGTCAAGAGAGAAGG + Intergenic
1055929095 9:81541243-81541265 TTCTACCATTTGAAGATATAAGG + Intergenic
1056469998 9:86896318-86896340 TTCTAAGAGATGAAAATAAAAGG + Intergenic
1057685182 9:97227046-97227068 TTCTAATACATGAATATAGAAGG - Intergenic
1058583925 9:106486598-106486620 TTCTACCACATGAAGATACAAGG - Intergenic
1203485556 Un_GL000224v1:50732-50754 TTCTTACTTTTGAAGAGAGAGGG + Intergenic
1186103154 X:6177942-6177964 TTCTACCACATGAGGATACAGGG + Intronic
1187445240 X:19355394-19355416 TTCTCACAGATGAAAATACAAGG - Exonic
1189033367 X:37471708-37471730 TTCTAACACAAGAAAATAAAAGG + Intronic
1190135609 X:47794715-47794737 TTCTAACATATGAACTTTGGGGG - Intergenic
1191961475 X:66707550-66707572 ATCTAACACATGAAGATATTTGG + Intergenic
1192603716 X:72491648-72491670 TTTTAAAATCTGAAGAAAGATGG + Intronic
1194494073 X:94587965-94587987 ATCTAGAATTTGAAGATAGAAGG - Intergenic
1195006678 X:100691975-100691997 TTCTAAAATATAAAGCTTGAAGG - Intronic
1195425136 X:104720428-104720450 TTCTAATATATTAGGACAGATGG + Intronic
1197616907 X:128702887-128702909 TTCCAACATATGAATTTTGAGGG - Intergenic
1197858359 X:130943340-130943362 TTTTAACATATGAATTTAGCAGG - Intergenic
1198624700 X:138557686-138557708 TTCTAACATATTAAAGTAGTAGG - Intergenic
1199336650 X:146626594-146626616 TTCTTAATTATGAACATAGATGG - Intergenic
1200106245 X:153714730-153714752 TTCCAACACATGAAGTTTGAAGG - Intronic
1201348885 Y:13016735-13016757 TTCTCATATATGATGAGAGATGG + Intergenic