ID: 911217008

View in Genome Browser
Species Human (GRCh38)
Location 1:95205902-95205924
Sequence CACCAGACAGTGAATCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 2, 2: 29, 3: 73, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911217008_911217011 6 Left 911217008 1:95205902-95205924 CCTGGCAGATTCACTGTCTGGTG 0: 1
1: 2
2: 29
3: 73
4: 195
Right 911217011 1:95205931-95205953 TGCTTCCAGGTTTCACATCCTGG 0: 1
1: 0
2: 35
3: 477
4: 2073
911217008_911217009 -7 Left 911217008 1:95205902-95205924 CCTGGCAGATTCACTGTCTGGTG 0: 1
1: 2
2: 29
3: 73
4: 195
Right 911217009 1:95205918-95205940 TCTGGTGAAGACCTGCTTCCAGG 0: 2
1: 25
2: 188
3: 629
4: 1467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911217008 Original CRISPR CACCAGACAGTGAATCTGCC AGG (reversed) Intronic
900358893 1:2278566-2278588 CACCACACAATGAATCTGCCGGG - Intronic
900778519 1:4601921-4601943 CAGCAGCCAGTGAACCTGGCAGG - Intergenic
900855118 1:5175178-5175200 TACCAGACACTGAATCTGCCAGG + Intergenic
902801540 1:18833033-18833055 CACCAGACAGAGGAGCAGCCTGG - Intergenic
902987244 1:20162334-20162356 CTCCAGACTGTGAAGGTGCCTGG - Intronic
903257480 1:22112658-22112680 CACCTGACAGCCAATCTGACAGG + Intergenic
903588404 1:24435928-24435950 CACCAGACACCCAATCTGCTGGG - Intronic
904636963 1:31889591-31889613 CACCAGACACTGAGGCTGTCAGG - Intergenic
905236015 1:36548797-36548819 CACCAAATACTGAATCTGCCAGG + Intergenic
906531225 1:46525235-46525257 GACCAGGCAGTGCAACTGCCAGG + Intergenic
906733333 1:48101801-48101823 CACCAGAAACTGACTCTTCCTGG - Intergenic
907015613 1:51009805-51009827 CACCAGATTGTGAAACTGCATGG + Intergenic
907477068 1:54712934-54712956 CACCAGACACCGAATCTGCCAGG + Intronic
907706135 1:56834341-56834363 CACTAGACACTGAATCTGCTGGG + Intergenic
908271755 1:62429320-62429342 CACCAGAAACTGAATCTGCTGGG + Intergenic
909538209 1:76761861-76761883 CACCAGACACTGAATCTGATGGG + Intergenic
911217008 1:95205902-95205924 CACCAGACAGTGAATCTGCCAGG - Intronic
911556124 1:99347119-99347141 CACCAGACACCAAATCTGCCAGG - Intergenic
911663153 1:100525964-100525986 CTCAAGAAAATGAATCTGCCGGG - Intergenic
912668736 1:111606595-111606617 CACCATACAGGGAGTCTGCAGGG + Intronic
912720901 1:112019075-112019097 CACCAGATACAGGATCTGCCAGG + Intergenic
913270763 1:117090879-117090901 CACCATATACTGAATCTGTCTGG + Intronic
916304560 1:163314871-163314893 CACCAGACATCAAAGCTGCCAGG + Intronic
916349476 1:163832870-163832892 CACCAGGCAATGAACCTGCCAGG - Intergenic
917678613 1:177343532-177343554 CAGCAGATAGTAAATCTGCCAGG + Intergenic
917757537 1:178117731-178117753 CACCAGACACTGAATCTAATGGG + Intronic
920081797 1:203380119-203380141 CACCAGACAGGGAAAATGGCAGG + Intergenic
921801458 1:219407825-219407847 CCCCAGAAACTGAATCTGCTGGG - Intergenic
922409300 1:225355174-225355196 CACCAGCCACTGAATCTGCTGGG - Intronic
922808517 1:228402814-228402836 CACCAGACACCAAACCTGCCAGG + Intronic
1063089019 10:2845175-2845197 CACTAGACATCAAATCTGCCAGG + Intergenic
1063089612 10:2850688-2850710 CACCAGACACCGAATCTGCCAGG - Intergenic
1064858917 10:19803760-19803782 CACCACACAGAGAATTAGCCTGG + Intergenic
1065964705 10:30761764-30761786 CGCCAGACACAGAATCTGCTGGG + Intergenic
1066177741 10:32926859-32926881 CACCAGATGCTCAATCTGCCTGG + Intronic
1067141756 10:43663682-43663704 CACCACACACTAAACCTGCCTGG - Intergenic
1068173622 10:53427303-53427325 CCCCAGTCATTGAATCTGCATGG - Intergenic
1068552891 10:58426209-58426231 CACCAGCCTGGGAAGCTGCCAGG - Intergenic
1069109633 10:64429939-64429961 CACTAGACACCAAATCTGCCAGG + Intergenic
1069138848 10:64799347-64799369 CATCAGACTCTGAATCTGCTGGG - Intergenic
1070454674 10:76600638-76600660 CACCAGGAACTAAATCTGCCAGG + Intergenic
1070538393 10:77396948-77396970 CACAAAACATTGAATCTGTCAGG + Intronic
1071148921 10:82610027-82610049 CATCAGGAAGTGAATCTGCCAGG - Intronic
1071162857 10:82771130-82771152 TACCAGAATGTTAATCTGCCTGG - Intronic
1071474361 10:86012791-86012813 CAGCAGACGCTGAATCTGCTGGG + Intronic
1075920090 10:126204188-126204210 CTCCAGTCAGTGGATCTGCTGGG + Intronic
1076546701 10:131250198-131250220 CACCAGACACTGAGACTGGCTGG + Intronic
1076730086 10:132434094-132434116 CACCAGACGCTGAATCTGCTGGG - Intergenic
1077563991 11:3284605-3284627 CACCCGGCCGTGAATCTACCTGG - Intergenic
1077569881 11:3330422-3330444 CACCCGGCCGTGAATCTACCTGG - Intergenic
1078461307 11:11517111-11517133 CACCAGACACTGAACCTGCTGGG + Intronic
1078921718 11:15836971-15836993 CACCAGCCTGTGACTCTGCAGGG + Intergenic
1080206843 11:29739164-29739186 CTCCAGACAGTGAATCCAGCAGG + Intergenic
1080403218 11:31956044-31956066 CACCAGCCACTGCCTCTGCCAGG - Intronic
1081260833 11:40958114-40958136 CACCACACACTGAATCTGCCAGG + Intronic
1082867387 11:57912299-57912321 CACCAGACACTGAAGCTTCCAGG + Intergenic
1086334845 11:85790162-85790184 CATCAGAAAGTGAAGATGCCAGG + Intronic
1087366338 11:97224603-97224625 CACCAGAAAGTGATTTTGGCAGG + Intergenic
1088312272 11:108472585-108472607 TTCCACACACTGAATCTGCCTGG + Exonic
1089259792 11:117216334-117216356 CCCCAGACACTGAATCAACCAGG + Intronic
1090480979 11:127067818-127067840 CACCTGACATTGAATTGGCCTGG - Intergenic
1091169997 11:133511542-133511564 CACCAGCCAGTCCTTCTGCCTGG + Intronic
1092365857 12:7876392-7876414 CCCCAGACAGTGAATTTGCTGGG + Intronic
1092948846 12:13481490-13481512 CACCAATCAGTAAATCAGCCTGG - Intergenic
1093241937 12:16687363-16687385 CACCAGACACCAAATCTGCCAGG - Intergenic
1094163849 12:27421740-27421762 CACAAGACATTTAATCTGCCCGG - Intronic
1095301138 12:40585515-40585537 CACAAGACAGCCAATCTGCCAGG - Intergenic
1096591080 12:52659590-52659612 ACCAAGAGAGTGAATCTGCCTGG + Intergenic
1097404583 12:59174876-59174898 CACTAGACACTGAATCTGCCAGG - Intergenic
1097736364 12:63186014-63186036 CACCACACTGTGAATTGGCCAGG - Intergenic
1098021366 12:66159617-66159639 CAATAGACAGCTAATCTGCCTGG + Intronic
1099494454 12:83328928-83328950 CACCCAAAAGTGAATCTGCTGGG - Intergenic
1100468544 12:94871108-94871130 CACCAGACGCTGAATCTGCTGGG - Intergenic
1100600089 12:96105429-96105451 CACCCAACACTGAATCTGCTGGG + Intergenic
1101235735 12:102787462-102787484 CACCGGACACTGAATCTGCTGGG + Intergenic
1101300367 12:103473517-103473539 CTCCATACAGTGAATGTGACAGG + Intronic
1102565693 12:113796110-113796132 CACCAGCCAGTGAATTTTCAAGG + Intergenic
1108374195 13:49798048-49798070 CACCAAACACAGAATCTGCTGGG + Intergenic
1109117486 13:58407012-58407034 CACCAGACACCAAATATGCCAGG + Intergenic
1109119236 13:58433239-58433261 CAGCAGACATCAAATCTGCCAGG - Intergenic
1111563192 13:89979346-89979368 TCCCAGACATTGAATCTGTCAGG + Intergenic
1111665931 13:91267671-91267693 CACCAGACACTGAATCTGCTTGG - Intergenic
1112102364 13:96203258-96203280 CACCAGACATTGCATCTACCTGG - Intronic
1112681922 13:101776853-101776875 CACCAAAAACTGAATTTGCCAGG - Intronic
1112916172 13:104553233-104553255 CACCACACAATGAATCTGACTGG - Intergenic
1113893240 13:113747683-113747705 TGCCAGACACAGAATCTGCCAGG + Intergenic
1116078284 14:40141336-40141358 CTTCAGACATTGAATCTACCAGG - Intergenic
1118350187 14:64968086-64968108 CAACAGGCATTGAATCTGCCTGG + Intronic
1120041930 14:79763630-79763652 CACCAGACATCACATCTGCCAGG - Intronic
1120327010 14:83042907-83042929 CACCAGACACTGAATCTTCCTGG - Intergenic
1120462764 14:84818089-84818111 CACCAGACACTGAACATACCAGG + Intergenic
1120684954 14:87527666-87527688 TACCAGACACTGAATCTTCAGGG - Intergenic
1121236239 14:92393127-92393149 CACCAGCCATCGAATCTGCTGGG + Intronic
1121263973 14:92587212-92587234 AACAAGACAGTTACTCTGCCAGG + Intronic
1122453866 14:101834541-101834563 CACCAGACACTGAATCTGGGAGG - Intronic
1122671535 14:103376453-103376475 CACCAGACACTATGTCTGCCAGG + Intergenic
1123707325 15:22959710-22959732 CAACAGACCGTGTATCTGCTGGG + Intronic
1123964735 15:25443607-25443629 CACCAGACACTAAACCTGCTGGG + Intergenic
1124815587 15:32988686-32988708 AACCAGACGGTGAATCTTACAGG + Intronic
1125380039 15:39077866-39077888 TACCAGACACCGAATCTGCCAGG - Intergenic
1128731946 15:70027174-70027196 CACAAAACGGTGAATCTGCCTGG + Intergenic
1130558981 15:84944177-84944199 CACCAGGCAGTGTAGCTGCCAGG - Intronic
1133173183 16:3994237-3994259 CACTGGACACTGAATCTTCCGGG + Intronic
1133538450 16:6724539-6724561 CACCAGACACCAAATCTACCAGG + Intronic
1133707614 16:8370130-8370152 CACCATACACTGAATCTGCTGGG - Intergenic
1134275679 16:12774119-12774141 GACCAGAAAGTGAGTCCGCCAGG + Intronic
1134340472 16:13340536-13340558 CCCCAGAGGGTGAATCTGACTGG - Intergenic
1134565253 16:15246440-15246462 CCCCAGACACTGAATCTGCCTGG - Intergenic
1134737243 16:16510258-16510280 CCCCAGACACTGAATCTGCCTGG + Intergenic
1136561680 16:31042699-31042721 CACGACACACTGGATCTGCCGGG - Intronic
1138709582 16:58955034-58955056 CACCAGACACCAAATCTGCCGGG - Intergenic
1139277131 16:65738390-65738412 CACCAGGGAGTGAATCTTTCTGG + Intergenic
1140334815 16:74095404-74095426 CACCAGACATTGAATCTGCCAGG - Intergenic
1141058978 16:80846736-80846758 CATCAGACACTGAATCTGCTGGG - Intergenic
1141861871 16:86722610-86722632 CACCAGACACTGAAGTGGCCAGG + Intergenic
1141981641 16:87553978-87554000 CACCAGACACCGAGTCTCCCGGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1144248730 17:13394612-13394634 ATCCAGACAGGGCATCTGCCAGG - Intergenic
1149453422 17:56767814-56767836 CTCCAGACAGAGAACCTGCCAGG + Intergenic
1150600657 17:66648054-66648076 CACCAGACACTGAATCTGCTGGG - Intronic
1151857383 17:76731334-76731356 CACCAGACACTGAACCTGTAAGG - Intronic
1153087367 18:1303342-1303364 CACCAGTCAGGGAATCTTCCTGG - Intergenic
1155180305 18:23339715-23339737 CACCAGACACGGAATCTGCAGGG - Intronic
1155513037 18:26596366-26596388 CACCAGAAAGTGAATCCTGCAGG + Intronic
1163643141 19:18473203-18473225 CACCAGCCTGTGAATCCACCGGG + Intronic
1164689986 19:30203591-30203613 CACCAGACTGTGAAACAGGCTGG - Intergenic
1165119728 19:33551412-33551434 CACCAGACACCGAATCTGCCTGG - Intergenic
1165466770 19:35979269-35979291 CACCAGACAGTCCTTCTTCCAGG + Intergenic
1167627705 19:50603673-50603695 GAGAAGACAGTGAATCTGCTGGG - Intergenic
1167628064 19:50605567-50605589 GAGAAGACAGTGAATCTGCTGGG - Intergenic
925217918 2:2113067-2113089 CAGGAGACAGTGAAGCTGGCAGG - Intronic
925271307 2:2609824-2609846 CACCAGACAAAAAATCTCCCAGG + Intergenic
925842683 2:8007127-8007149 CACCACACATTGAATCTGTCAGG + Intergenic
926259241 2:11242056-11242078 CACCAGACAACAAATCTGCCAGG + Intronic
927467395 2:23347704-23347726 CAGCAGACTGTGACTGTGCCAGG + Intergenic
927499940 2:23575874-23575896 CACCAGGGAGTCTATCTGCCAGG - Intronic
928306052 2:30171299-30171321 CACCAGACACTGAATCTGCTGGG - Intergenic
928361392 2:30664849-30664871 CAGCCAACACTGAATCTGCCTGG + Intergenic
930237063 2:48898594-48898616 CACCAGACACTAAATCTGCTGGG + Intergenic
930496379 2:52149610-52149632 CACCAGACACTTGATCTGTCAGG + Intergenic
930912853 2:56650842-56650864 CATCAGATATTGAATCTGCCTGG + Intergenic
934656732 2:96120306-96120328 CACCATGCTGTGACTCTGCCTGG + Intergenic
935708344 2:105875685-105875707 CACCAGACACCGAATCTCCTGGG + Intronic
935744346 2:106177707-106177729 CACCAGATACTGAATCTGCTGGG + Intronic
936153483 2:110033970-110033992 CCCCAGGCAGTGGCTCTGCCCGG - Intergenic
936191198 2:110337445-110337467 CCCCAGGCAGTGGCTCTGCCCGG + Intergenic
938171443 2:129080292-129080314 CACCAGACCTTTAATCTGACAGG - Intergenic
938248152 2:129794735-129794757 CAACACACAGTGAATGTTCCGGG + Intergenic
938412457 2:131076152-131076174 CTCCAGACAGTGAATCTGCAGGG + Intronic
938539741 2:132276060-132276082 AACCAGACAGTGGATGTGACAGG + Intergenic
939273296 2:139967818-139967840 TATCAGTCAGTCAATCTGCCAGG + Intergenic
940514660 2:154666763-154666785 CACCAGACACCAAATCTGCTGGG + Intergenic
946932254 2:224681908-224681930 CACCAGACATTGAATGTGCCTGG + Intergenic
947841115 2:233208541-233208563 CACCAGGCAGTGAGCCTGCAGGG - Intergenic
948035342 2:234853831-234853853 CATCAGACACTGAATCTGCTAGG - Intergenic
948304571 2:236936765-236936787 CACCGGACAATAAAGCTGCCTGG - Intergenic
948523212 2:238554594-238554616 CACCAGACACCGAAGCTGCTGGG - Intergenic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
949023807 2:241755576-241755598 TCCCAGACAGTGAATGTCCCAGG - Intronic
1168850037 20:970126-970148 CACCAGAATGTGTATCTGACCGG - Intronic
1171868670 20:30508969-30508991 AACCAGACAGTGGATGTGACGGG + Intergenic
1172410408 20:34717638-34717660 CAGAAGACAGTTAATCTGCCAGG + Intronic
1175757953 20:61541793-61541815 CTCCAGCCAGTGAGTGTGCCAGG + Intronic
1177417663 21:20815465-20815487 CATCAGACACTGAATCTACTGGG - Intergenic
1179335216 21:40445026-40445048 CACCAGACACAGAATCTCCTGGG - Intronic
1181775515 22:25157397-25157419 CACTAGACAGTGAATCTTGGAGG + Intronic
1182963727 22:34502248-34502270 CACCAGGCAGGGATTCTGGCAGG + Intergenic
1184249067 22:43249929-43249951 CACCAGAAAGGGAAGCCGCCAGG - Intronic
1184374728 22:44104553-44104575 ATCCAGACAGGGAATATGCCTGG - Intronic
1184931249 22:47682733-47682755 CACCAGATGCTGAACCTGCCTGG - Intergenic
1185303609 22:50099308-50099330 CACCAGACCCGGAATCTGCCAGG + Intronic
951319877 3:21231409-21231431 CACCAAACACTAAATCTGCCAGG + Intergenic
952817618 3:37459361-37459383 TACCAGACAGCAAATCTGCTGGG - Intronic
952851860 3:37735978-37736000 CGCCAGGAACTGAATCTGCCGGG - Intronic
953395891 3:42569454-42569476 CACCAGACACTGAAGCAGCGAGG + Intronic
953429927 3:42830734-42830756 CATCAGAAACTGAATCTGCTGGG + Intronic
955318478 3:57958117-57958139 CACCAGACATAGAATCTGCTGGG + Intergenic
956582150 3:70826027-70826049 CACCAGACACCAAATCTGCTGGG + Intergenic
956588320 3:70886887-70886909 CATCAGACACTGAATCTGTTGGG + Intergenic
957587381 3:82149684-82149706 CACCAGACATGAAATCTGCCAGG - Intergenic
957684353 3:83481501-83481523 CACCAGACATGAAATCTGCTGGG + Intergenic
959165512 3:102772600-102772622 CACCAGAAAGTGAGTCTGCTTGG - Intergenic
959310280 3:104727315-104727337 CACCAGACACCAAATCTGCCTGG - Intergenic
959470373 3:106742687-106742709 CACCAGAGACTGAATCTGATGGG - Intergenic
959488909 3:106963133-106963155 ACCCAGACAGTGGCTCTGCCAGG + Intergenic
960546673 3:118922767-118922789 TACCAGACACTGAATCTGCTGGG - Intronic
960895844 3:122504249-122504271 CACCAGATACTGAATTAGCCAGG - Intronic
961456156 3:127025043-127025065 GTCCAGTCAGTGAACCTGCCAGG + Intronic
961808620 3:129507534-129507556 CACCACACAGTGTCTGTGCCAGG - Intronic
961902493 3:130226607-130226629 CACCAAACACTGAATCTTCCAGG - Intergenic
961911226 3:130318489-130318511 CATCAGGCAGTGAATGTGGCTGG + Intergenic
962797509 3:138861940-138861962 CACCAGACCGTGAGTGTCCCGGG + Intergenic
964306771 3:155349729-155349751 CACTAGACACTGAGTCTGCCAGG - Intergenic
964307837 3:155359925-155359947 CATCAGACACTCAGTCTGCCAGG - Intergenic
964330705 3:155599086-155599108 CACCAGGAAGTGAATCTGTTGGG + Intronic
964844437 3:161030422-161030444 CCCCAGATACTGAATTTGCCAGG + Intronic
965083564 3:164065877-164065899 CACCAGACATCAAATCTGCCAGG - Intergenic
965467216 3:169044929-169044951 CACCTGACACTGATTCTGTCTGG + Intergenic
966750957 3:183321924-183321946 CACCAGACACCAAATCTGCTGGG - Intronic
968380623 4:92850-92872 CACCAGACTGTGAAGCAGCTGGG - Intergenic
969170395 4:5357694-5357716 CACCAGAAAGTGAAACTAGCAGG - Intronic
971118777 4:23680342-23680364 CGCCAGACACTGAATCTTCTGGG + Intergenic
973633094 4:52837946-52837968 CTCCAGTCAGTGCCTCTGCCTGG - Intergenic
974869539 4:67622683-67622705 ATAAAGACAGTGAATCTGCCAGG - Intronic
974905114 4:68045569-68045591 CACCAGACATTGAATCTGTCTGG + Intergenic
976943993 4:90741508-90741530 CATCAGATACTGAATCTGGCTGG + Intronic
977980556 4:103315995-103316017 CACCAGACACAGAATCTGCCAGG - Intergenic
980900742 4:138902731-138902753 CACCAGACACCAAATCTGCTGGG - Intergenic
982171196 4:152663237-152663259 CCCCAGAAGGTTAATCTGCCTGG + Intronic
983267492 4:165522748-165522770 CTGCAGACACTGAATCTGCCAGG + Intergenic
983558599 4:169079632-169079654 CAACAGACAGAAAATCAGCCAGG + Intergenic
983849672 4:172565019-172565041 CTCCAGACACTGAATCTGCTGGG - Intronic
983947456 4:173602456-173602478 CACAAGACAGTGTTTCTGACTGG - Intergenic
985274157 4:188221331-188221353 TACCTGAGAGTGAAACTGCCAGG - Intergenic
985714318 5:1446785-1446807 CACCAGACACAGAGTCGGCCAGG - Intergenic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
986534907 5:8776766-8776788 CACAAGACAGTGAAATTACCAGG + Intergenic
986673900 5:10167330-10167352 CACCAGACACCGAATCTGCCAGG - Intergenic
986844220 5:11734102-11734124 CCCCAGACACTAAATCTGCCAGG + Intronic
987216850 5:15746467-15746489 CACCAGACACTAAATCTGCCAGG - Intronic
987277531 5:16377441-16377463 CACCGGACATGGAATCTGCTGGG - Intergenic
989109137 5:37890243-37890265 CCCCAGCCAGTGACTCTGCAGGG + Intergenic
989182641 5:38593853-38593875 CACCAGGCTCTGATTCTGCCTGG + Intronic
989633504 5:43511280-43511302 AACCAGACAGGGCAGCTGCCGGG - Intronic
990064231 5:51692804-51692826 GACCAGACACTGAATTTGCCAGG - Intergenic
992547904 5:77833094-77833116 CACCAGACAATTACACTGCCCGG - Intronic
992598038 5:78366038-78366060 CACCATACACTGAATCTGCTGGG - Intronic
993878394 5:93336028-93336050 CAGCAGACACTGAAGCTGCTGGG - Intergenic
994552061 5:101247539-101247561 CACCAGACACTGGATCCACCAGG + Intergenic
996214029 5:120845939-120845961 CGCTAGACACTGAATTTGCCAGG + Intergenic
997219509 5:132149175-132149197 TACCAGACAGTGAATCTGCTGGG - Intergenic
1000577190 5:162988862-162988884 CACTAGACATTGAATTTGCTGGG - Intergenic
1000676059 5:164124014-164124036 CACCAAACACTGATTTTGCCAGG - Intergenic
1001168303 5:169391961-169391983 AACCAGACATGGAATCTGTCTGG + Intergenic
1001639564 5:173235144-173235166 CACCATGCAGGGAAGCTGCCAGG - Exonic
1001825967 5:174745320-174745342 CACCAGACACTGAACCTGGCCGG - Intergenic
1003652833 6:7977139-7977161 CACCAGATACCAAATCTGCCAGG - Intronic
1005390319 6:25326257-25326279 CACAATATATTGAATCTGCCTGG - Intronic
1005446871 6:25933014-25933036 CACCAGACACTAAATTTGCCAGG + Intergenic
1006698104 6:35948967-35948989 CAGCAGACACTGAAACTGCCAGG + Intronic
1007375211 6:41451711-41451733 CACAACACAGTGACTCTGACAGG + Intergenic
1010672998 6:78709036-78709058 CATCAGACACTGAATCTGCCAGG - Intergenic
1011621345 6:89245735-89245757 CACCACACACTGAATCAGCCAGG + Intergenic
1012824382 6:104128329-104128351 CACCAGACACTGAATTTTCCAGG - Intergenic
1013096349 6:106948798-106948820 CATCAGGCAAGGAATCTGCCAGG - Intergenic
1013462418 6:110387749-110387771 GCCCACACAGTGAATCTTCCAGG + Intergenic
1013912019 6:115287306-115287328 CACCAGGCAGGGAATTTTCCAGG + Intergenic
1014515120 6:122368612-122368634 CACCAGGCACTGAACCTGCCAGG - Intergenic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1016294669 6:142562221-142562243 CACCAGACACCAAATCTGCTGGG - Intergenic
1016734331 6:147460184-147460206 AAGGAGACAGTGAATCTGCCAGG + Intergenic
1016870237 6:148808905-148808927 CACCAGGAATTGAATCTGCTGGG + Intronic
1017893704 6:158660601-158660623 CACCACTCAGTGAATCTGGTGGG - Intronic
1018344627 6:162887983-162888005 CACCACACACTGAACCTGCTGGG - Intronic
1019893544 7:3965777-3965799 CCCCAGACAGTGTGGCTGCCGGG + Intronic
1020920839 7:14262472-14262494 CTTCAGACATTGAATCTGCCTGG + Intronic
1023854018 7:44169861-44169883 CATCAGACAGTGAATTAGCTTGG + Intronic
1024198883 7:47086876-47086898 CACCAGACACCAAATCTGCCAGG + Intergenic
1024550194 7:50556278-50556300 CACCAGATACCAAATCTGCCGGG - Intronic
1030618966 7:111769054-111769076 CACCAGACACTGTATCTGCCAGG + Intronic
1031809779 7:126352045-126352067 CACCAGGTATTGAATCTTCCAGG - Intergenic
1034232069 7:149538173-149538195 CACCAGACATGGAATCTGCTGGG + Intergenic
1034402694 7:150876027-150876049 CCCCAGACACTGAAGCTGCCAGG - Intergenic
1034971949 7:155424667-155424689 CACCAGTCAATGATTCTGTCTGG + Intergenic
1035680980 8:1487944-1487966 CACCTCACAGTGAATGTCCCGGG - Intergenic
1035830320 8:2688453-2688475 CACCAGACACCAAATCTGCCTGG - Intergenic
1035872402 8:3150132-3150154 CATGAGGCAGTGATTCTGCCAGG - Intronic
1036180651 8:6581814-6581836 CACCAGACATGGAATCTGCCTGG - Intronic
1039165120 8:34670330-34670352 CACCAGACACCAGATCTGCCAGG + Intergenic
1040605554 8:48927868-48927890 CACCAGACTCTGAATCTGCCCGG + Intergenic
1042400532 8:68341135-68341157 CACCAGACACCAAATCTGCCAGG - Intronic
1042474678 8:69233727-69233749 CACCAGACATTGAATCTGCTGGG - Intergenic
1043487312 8:80710716-80710738 AACCAAAAACTGAATCTGCCAGG + Intronic
1045099993 8:98834581-98834603 CACCAGACACTGAATCTGCCAGG - Intronic
1047181126 8:122589149-122589171 CAGAAGACAGTGAATGTGGCTGG - Intergenic
1047881783 8:129202647-129202669 CTCTAGAGAGTGAATCAGCCAGG - Intergenic
1048997505 8:139803464-139803486 CTCCAGACAGTGCAACTGCAGGG + Intronic
1049628468 8:143637370-143637392 CAACACACAGTGACTCTGGCTGG + Intronic
1050023227 9:1306850-1306872 AACCTGACACTGGATCTGCCGGG - Intergenic
1051733136 9:20168830-20168852 CACCTGAGAGTGAAACTGCCGGG - Intergenic
1051813993 9:21082916-21082938 CATCAGACACTGAATCTGCTAGG - Intergenic
1055354256 9:75421150-75421172 CACCAGACATAGAATTTGCCAGG - Intergenic
1056799928 9:89683885-89683907 CAGCAGACAGTGTGTCTGCTGGG + Intergenic
1057437549 9:95056234-95056256 CCCCAGACAGAGAATAAGCCTGG - Intronic
1058162966 9:101590296-101590318 CACCAGACTGAGAATCAGACCGG - Intronic
1060808591 9:126595323-126595345 CACCAGACACCAAATCTGCTGGG + Intergenic
1186364423 X:8876074-8876096 CACCAGACACCAAATCTGCTGGG + Intergenic
1189080329 X:37964244-37964266 CACTAGACAAAAAATCTGCCTGG + Intronic
1190302439 X:49064615-49064637 CACCACCCAGGGAGTCTGCCTGG + Exonic
1192094703 X:68198364-68198386 CACCAGACACTGAAACTGCTTGG + Intronic
1192272184 X:69591383-69591405 CACCAGACACTGAATCTGCTGGG + Intergenic
1196031888 X:111100758-111100780 CCCCAGACAGAGATTCTGTCAGG + Intronic
1196372123 X:114990959-114990981 CACCAGACACTGAATCTTGTTGG + Intergenic
1198574109 X:137991286-137991308 CACCAGACACCAAATCTGCCAGG + Intergenic
1198996881 X:142582695-142582717 CTCAAGTCAGTGAAACTGCCAGG + Intergenic
1199721621 X:150546799-150546821 CACAACACAGTGAATGTGCTGGG + Intergenic
1199742414 X:150748003-150748025 CACCAGACACTGAATCTGCTGGG - Intronic
1199877726 X:151948082-151948104 CACCAGACACAGAATCTGCCAGG + Intergenic
1199910480 X:152281475-152281497 CACAAGCCTGTGAAACTGCCAGG + Intronic