ID: 911225916

View in Genome Browser
Species Human (GRCh38)
Location 1:95305489-95305511
Sequence GTACTCCTCCCATCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911225916_911225924 2 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225924 1:95305514-95305536 AAAGAAAACGGGGTGGGGCTGGG No data
911225916_911225923 1 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225923 1:95305513-95305535 GAAAGAAAACGGGGTGGGGCTGG No data
911225916_911225918 -9 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225918 1:95305503-95305525 GAGGAGTACAGAAAGAAAACGGG No data
911225916_911225920 -5 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225920 1:95305507-95305529 AGTACAGAAAGAAAACGGGGTGG No data
911225916_911225921 -4 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225921 1:95305508-95305530 GTACAGAAAGAAAACGGGGTGGG No data
911225916_911225926 20 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225926 1:95305532-95305554 CTGGGTGGTGAAGTGTAAAGAGG No data
911225916_911225922 -3 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225922 1:95305509-95305531 TACAGAAAGAAAACGGGGTGGGG No data
911225916_911225927 26 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225927 1:95305538-95305560 GGTGAAGTGTAAAGAGGCAGTGG No data
911225916_911225919 -8 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225919 1:95305504-95305526 AGGAGTACAGAAAGAAAACGGGG No data
911225916_911225925 5 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225925 1:95305517-95305539 GAAAACGGGGTGGGGCTGGGTGG No data
911225916_911225917 -10 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225917 1:95305502-95305524 GGAGGAGTACAGAAAGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911225916 Original CRISPR GTACTCCTCCCATCTGCAAA TGG (reversed) Intergenic
No off target data available for this crispr