ID: 911225921

View in Genome Browser
Species Human (GRCh38)
Location 1:95305508-95305530
Sequence GTACAGAAAGAAAACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911225916_911225921 -4 Left 911225916 1:95305489-95305511 CCATTTGCAGATGGGAGGAGTAC No data
Right 911225921 1:95305508-95305530 GTACAGAAAGAAAACGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911225921 Original CRISPR GTACAGAAAGAAAACGGGGT GGG Intergenic
No off target data available for this crispr