ID: 911233698

View in Genome Browser
Species Human (GRCh38)
Location 1:95386908-95386930
Sequence GGATGGACTCCATTTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911233698_911233705 16 Left 911233698 1:95386908-95386930 CCTGGTTGAAATGGAGTCCATCC No data
Right 911233705 1:95386947-95386969 TGTCTCCTCCTGTCATGTTGTGG No data
911233698_911233706 17 Left 911233698 1:95386908-95386930 CCTGGTTGAAATGGAGTCCATCC No data
Right 911233706 1:95386948-95386970 GTCTCCTCCTGTCATGTTGTGGG No data
911233698_911233700 -7 Left 911233698 1:95386908-95386930 CCTGGTTGAAATGGAGTCCATCC No data
Right 911233700 1:95386924-95386946 TCCATCCCCTAGATGAGAGGAGG No data
911233698_911233709 27 Left 911233698 1:95386908-95386930 CCTGGTTGAAATGGAGTCCATCC No data
Right 911233709 1:95386958-95386980 GTCATGTTGTGGGTGAGACACGG No data
911233698_911233699 -10 Left 911233698 1:95386908-95386930 CCTGGTTGAAATGGAGTCCATCC No data
Right 911233699 1:95386921-95386943 GAGTCCATCCCCTAGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911233698 Original CRISPR GGATGGACTCCATTTCAACC AGG (reversed) Intergenic
No off target data available for this crispr