ID: 911238842

View in Genome Browser
Species Human (GRCh38)
Location 1:95442271-95442293
Sequence CTTGCTAAGTCCCTAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911238836_911238842 12 Left 911238836 1:95442236-95442258 CCCTGTCCTGAGAGCTTTGAACA No data
Right 911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG No data
911238837_911238842 11 Left 911238837 1:95442237-95442259 CCTGTCCTGAGAGCTTTGAACAA No data
Right 911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG No data
911238838_911238842 6 Left 911238838 1:95442242-95442264 CCTGAGAGCTTTGAACAATCCCA No data
Right 911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG No data
911238835_911238842 19 Left 911238835 1:95442229-95442251 CCTCTGACCCTGTCCTGAGAGCT No data
Right 911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911238842 Original CRISPR CTTGCTAAGTCCCTAGAGAG AGG Intergenic
No off target data available for this crispr