ID: 911239520

View in Genome Browser
Species Human (GRCh38)
Location 1:95449694-95449716
Sequence AAAGAGAGCACAGTGCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239520_911239527 24 Left 911239520 1:95449694-95449716 CCCACAAGCACTGTGCTCTCTTT No data
Right 911239527 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
911239520_911239528 25 Left 911239520 1:95449694-95449716 CCCACAAGCACTGTGCTCTCTTT No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239520_911239529 26 Left 911239520 1:95449694-95449716 CCCACAAGCACTGTGCTCTCTTT No data
Right 911239529 1:95449743-95449765 AAGCCACATGACTGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239520 Original CRISPR AAAGAGAGCACAGTGCTTGT GGG (reversed) Intergenic
No off target data available for this crispr