ID: 911239521

View in Genome Browser
Species Human (GRCh38)
Location 1:95449695-95449717
Sequence GAAAGAGAGCACAGTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239521_911239528 24 Left 911239521 1:95449695-95449717 CCACAAGCACTGTGCTCTCTTTC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239521_911239529 25 Left 911239521 1:95449695-95449717 CCACAAGCACTGTGCTCTCTTTC No data
Right 911239529 1:95449743-95449765 AAGCCACATGACTGCTGCTGGGG No data
911239521_911239527 23 Left 911239521 1:95449695-95449717 CCACAAGCACTGTGCTCTCTTTC No data
Right 911239527 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239521 Original CRISPR GAAAGAGAGCACAGTGCTTG TGG (reversed) Intergenic
No off target data available for this crispr