ID: 911239524

View in Genome Browser
Species Human (GRCh38)
Location 1:95449719-95449741
Sequence GAGAGAGAATCTGCATGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239524_911239532 12 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239532 1:95449754-95449776 CTGCTGCTGGGGAACAGGAGAGG No data
911239524_911239533 13 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239524_911239531 7 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data
911239524_911239527 -1 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239527 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
911239524_911239529 1 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239529 1:95449743-95449765 AAGCCACATGACTGCTGCTGGGG No data
911239524_911239534 14 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239524_911239528 0 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239524_911239535 17 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239524 Original CRISPR GAGAGAGAATCTGCATGTTT GGG (reversed) Intergenic