ID: 911239525

View in Genome Browser
Species Human (GRCh38)
Location 1:95449720-95449742
Sequence GGAGAGAGAATCTGCATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239525_911239534 13 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239525_911239527 -2 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239527 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
911239525_911239533 12 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239525_911239532 11 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239532 1:95449754-95449776 CTGCTGCTGGGGAACAGGAGAGG No data
911239525_911239531 6 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data
911239525_911239535 16 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239525_911239528 -1 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239525_911239529 0 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239529 1:95449743-95449765 AAGCCACATGACTGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239525 Original CRISPR GGAGAGAGAATCTGCATGTT TGG (reversed) Intergenic
No off target data available for this crispr