ID: 911239526

View in Genome Browser
Species Human (GRCh38)
Location 1:95449741-95449763
Sequence CCAGCAGCAGTCATGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239526_911239533 -9 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239526_911239532 -10 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239532 1:95449754-95449776 CTGCTGCTGGGGAACAGGAGAGG No data
911239526_911239534 -8 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239526_911239535 -5 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239526 Original CRISPR CCAGCAGCAGTCATGTGGCT TGG (reversed) Intergenic