ID: 911239528

View in Genome Browser
Species Human (GRCh38)
Location 1:95449742-95449764
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239524_911239528 0 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239520_911239528 25 Left 911239520 1:95449694-95449716 CCCACAAGCACTGTGCTCTCTTT No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239521_911239528 24 Left 911239521 1:95449695-95449717 CCACAAGCACTGTGCTCTCTTTC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239523_911239528 1 Left 911239523 1:95449718-95449740 CCCCAAACATGCAGATTCTCTCT No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239525_911239528 -1 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data
911239522_911239528 2 Left 911239522 1:95449717-95449739 CCCCCAAACATGCAGATTCTCTC No data
Right 911239528 1:95449742-95449764 CAAGCCACATGACTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type